Iright
BRAND / VENDOR: BD

BD, 572241, BD® OMICS-One Adaptive Protein Panel

CATALOG NUMBER: 572241
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

Reactivity: Human (Tested in Development)
Application: Single Cell 3' Sequencing (Qualified)
Regulatory Status: RUO
Storage Buffer: Lyophilized powder containing BSA and ≤ 0.25% sodium azide.
Description: Description The BD® OMICS-One Adaptive Protein Panel consists of 4 single tubes, 2 tubes of T-Cell Protein Panel (1 test/tube) containing 30 different specificities against major T-cell markers and 2 tubes of B-Cell Protein Panel (1 test/tube) containing 30 different specificities against major B-cell markers. Designed and optimized to work on the BD Rhapsody™ System, the Adaptive Protein Panel is tested to work seamlessly alongside the BD Rhapsody™ Whole Transcriptome Analysis (WTA) Assay, Targeted mRNA Assay, BD® Single-Cell Multiplexing Kit (SMK), BD® Intracellular CITE-seq (IC-AbSeq) Assay, and BD Rhapsody™ TCR/BCR Next Multiomic Assay for humans. The individual antibodies were each conjugated to an oligonucleotide that contains a specific antibody barcode sequence flanked by a polyA tail on the 3' end and a common PCR handle (PCR primer binding site) on the 5' end. All AbSeq barcode sequences were generated in silico with minimal sequence similarity to the human genomes, have low predicted secondary structure, and have high Hamming distance within the BD antibody-oligo portfolio, to allow for sequencing error correction and unique mapping. The polyA tail of the oligonucleotide allows the barcode sequence to be captured by the BD Rhapsody™ Enhanced Cell Capture Beads. The 5' PCR handle allows for efficient sequencing library generation for various sequencing platforms. Each individual antibody exists at an optimal concentration within the 59-plex panel to enable superior target and population resolution. The Adaptive Protein Panel is designed with SMART technology. SMART technology helps lower sequencing cost while increasing data resolution by attenuating antibodies that target high-expressing primary markers and allowing re-allocation of sequencing reads to markers expressed at lower levels. With SMART technology, markers low in expression can be quantified without having to do deeper sequencing and incurring high sequencing cost. There are four specificities attenuated in the Adaptive Protein Panel: CD4, CD44, CD43, and HLA-DR.
Preparation And Storage: Preparation And Storage Store at 2-8°C and protected from prolonged exposure to light. Do not freeze.
Recommended Assay Procedures: Recommended Assay Procedures 1. Remove one tube of BD® OMICS-One T-Cell Protein Panel and one tube of BD® OMICS-One B-Cell Protein Panel from foil bags and bring up to room temperature for 5 minutes. 2. Make sure both pellets are located at the bottom of the tubes. If not, briefly centrifuge to collect the contents at the tube bottom. 3. For each tube, add 35 µL of nuclease-free water to the bottom of the tube and allow antibodies to reconstitute for 5 minutes at room temperature. 4. Transfer the reconstituted antibodies on ice until the cells are ready for staining. Note: Reconstitute antibodies immediately before cell staining. Prolonged incubation of reconsituted antibody might increase the non-specific background. 5. For BD® AbSeq Ab-Oligo drop-in of 42 plex  or lower, prepare the BD® AbSeq labeling MasterMix using the procedure in the following two tables in 1.5-mL LoBind tube on ice. Note: For drop-in with more than 42 plex, reach out to technical support for calculation. For sequential labeling with Sample Tags or no Sample Tags, prepare BD® AbSeq labeling MasterMix for drop-ins as follows: ____________________________________________________________________________________________ Component                           1 sample (µL)       1 sample +          2 samples + 30% overage (µL)    30% overage (µL) Per BD® AbSeq Ab-Oligo              2.0                 2.6                 5.2 Total of BD® AbSeq Ab-Oligo         2.0 × N*            2.6 × N             5.2 × N FBS † (catalog number 554656)        105 – (2.0 x N)     137 – (2.6 x N)     273 – (5.2 x N) Total                               105                 137                 273 For co-labeling with Sample Tags, prepare BD® AbSeq labeling MasterMix for drop-ins as follows: ____________________________________________________________________________________________ Component                           1 sample (µL)       1 sample +          2 samples + 30% overage (µL)    30% overage (µL) Per BD® AbSeq Ab-Oligo              2.0                 2.6                 5.2 Total of BD® AbSeq Ab-Oligo         2.0 × N*            2.6 × N             5.2 × N FBS † (catalog number 554656)        85 – (2.0 × N)      111 – (2.6 × N)     221 – (5.2 × N) Total                               85                  111                 221 *  N = number of drop-in antibodies. N = 0 if there are no drop-in antibodies. †  FBS = BD Pharmingen™ Stain Buffer. 6. Pipet-mix the BD® AbSeq labeling MasterMix for drop-ins. Briefly centrifuge to collect the contents at the bottom, and place back on ice. 7. For sequential labeling with Sample Tags or no Sample Tags, for each sample, combine the two tubes containing 35 µL reconstituted T-Cell Protein Panel solution and 35 µL reconstituted B-cell Protein Panel solution. Then add 105 µL BD® AbSeq labeling MasterMix of drop-ins to the tube containing 70 µL reconstituted T-cell and B-cell Protein Panel solution to make a total volume of 175 µL. For co-labeling with Sample Tags, for each sample, first combine the two tubes containing 35 µL reconstituted T-Cell and 35 µL reconstituted B-Cell Protein Panel solution. Then add 85 µL BD® AbSeq labeling MasterMix of drop-ins and 20 µL Sample Tag to the tube containing 70µL reconstituted T-Cell and B-Cell Protein Panel solution to make a total volume of 175 µL. 8. Pipet-mix the mixture, briefly centrifuge to collect the contents at the tube bottom, and place back on ice. 9. Centrifuge cells at 400 × g for 5 minutes. If Fc Block is used, proceed to step 10. If Fc Block is not used. skip to step 11. 10. (Optional) For samples containing myeloid and B lymphocytes, BD Biosciences recommends blocking nonspecific Fc Receptor–mediated false-positive signals with Human BD Fc Block (Cat. No. 564220). a. To perform blocking, pipet the Fc Block MasterMix into a new 1.5-mL LoBind tube on ice: _________________________________________________________________________________ Component                           1 sample (µL)*    1 sample + 20% overage (µL) FBS† (catalog number 554656)        20.0              24.0 Fc Block‡ (catalog number 564220)   5.0               6.0 Total                               25.0              30.0 *  Sufficient for up to 1 million cells. To block more cells, adjust the volume. †  FBS = BD Pharmingen™ Stain Buffer. ‡ Fc Block =  BD Pharmingen™ Human BD Fc Block. b. Pipet-mix the Fc Block MasterMix and briefly centrifuge. Place on ice. c. Remove the supernatant from the cells without disturbing the pellet. d. Resuspend the cells in 25 µL of Fc Block MasterMix. e. Incubate the cells at room temperature (15°C to 25°C) for 10 minutes. f. Add 175 µL of BD® AbSeq labeling MasterMix from Step 8 into the cell suspension. Pipet-mix and proceed to Step 12. 11. Remove the supernatant from the cells without disturbing the pellet. Add 25 µL Stain Buffer (FBS) to the 175 µL of BD® AbSeq labeling MasterMix from Step 8  to make a total volume of 200 µL. Resuspend the cell pellet in 200 µL total volume. Pipet-mix. 12. Transfer the cells with BD® AbSeq labeling MasterMix into a new 5-mL polystyrene Falcon tube. 13. Stain the cells on ice for 30 minutes. 14. Add 3–4 mL Stain Buffer (FBS) to labelled cells and pipet-mix. 15. Centrifuge at 400 × g for 5 minutes. 16. Uncap the tube and invert to decant supernatant into biohazardous waste. Keep the tube inverted and gently blot on a lint-free wiper to remove residual supernatant from tube rim. 17. Repeat steps 14–16 twice more for a total of three washes. 18. Resuspend the final washed cell pellet in 620 µL cold Sample Buffer from the BD Rhapsody™ Enhanced Cartridge Reagent V3 (Cat. No. 667052) and proceed to single cell capture with on-cartridge washing steps described in the following substeps. Refer to the BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252) or BD Rhapsody™ HT Xpress System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24253) for additional details. Note: Perform on-cartridge washing after cell settling (8-minute incubation) as follows: a. At the protocol section of "Loading cells in BD Rhapsody™ 8-Lane Cartridge", after cell load, incubate the cartridge in the dark at room temperature for 8 minutes. b. Place the cartridge on BD Rhapsody™ HT Xpress and perform the following operations: _____________________________________________________________ Material to load        Volume (µL) 1 lane      Pipette Mode Air                     380                     Prime/Wash Cold Sample Buffer      380                     Prime/Wash Air                     380                     Prime/Wash Cold Sample Buffer      380                     Prime/Wash c. (Optional) Perform the scanner step: Cell Load Scan, if using BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252). No need for 8-minute delay before scanning. Warning : All biological specimens and materials are considered biohazardous. Handle as if capable of transmitting infection and dispose using proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves. List of all 30 Human AbSeq specificities included in the BD® OMICS-One T-Cell panel: ________________________________________________________________________________ Specificity      Clone          Oligo ID   BD® AbSeq Barcode Sequence CD103            Ber-ACT8       AHS0001    AAATAGTATCGAGCGTAGTTAAGTTGCGTAGCCGTT CD137            4B4-1          AHS0003    TGACAAGCAACGAGCGATACGAAAGGCGAAATTAGT CD45RA           HI100          AHS0009    AAGCGATTGCGAAGGGTTAGTCAGTACGTTATGTTG CD69             FN50           AHS0010    CAATAACGGGTCATAGTAAGTCGCGAGTAAGAGGGC CD278            DX29           AHS0012    ATAGTCCGCCGTAATCGTTGTGTCGCTGAAAGGGTT CD134 (OX40)     ACT35          AHS0013    GGTGTTGGTAAGACGGACGGAGTAGATATTCGAGGT CD279 (PD-1)     EH12.1         AHS0014    ATGGTAGTATCACGACGTAGTAGGGTAATTGGCAGT CD366 (TIM-3)    7D3            AHS0016    TAGGTAGTAGTCCCGTATATCCGATCCGTGTTGTTT CD223 (Lag3)     T47-530        AHS0018    CGGCATGAATTAGGCGAGACTTAGTATACGAGCTGG CD95 (Fas)       DX2            AHS0023    GGCCCGTTAGAGTTGGTATCCGTATGAAGGTTAGCT CD25             2A3            AHS0026    AGTTGTATGGGTTAGCCGAGAGTAGTGCGTATGATT CD127            HIL-7R-M21     AHS0028    AGTTATTAGGCTCGTAGGTATGTTTAGGTTATCGCG CD183            1C6/CXCR3      AHS0031    AAAGTGTTGGCGTTATGTGTTCGTTAGCGGTGTGGG CD4              SK3            AHS0032    TCGGTGTTATGAGTAGGTCGTCGTGCGGTTTGATGT CD196 (CCR6)     11A9           AHS0034    ACGTGTTATGGTGTTGTTCGAATTGTGGTAGTCAGT CD45RO           UCHL1          AHS0036    TGAGAGGTTATTGGGCGTATGACTTCGGTGATTGTG CD194 (CCR4)     1G1            AHS0038    AATATTAGTGGGTCCTCGCGTTGGCCGGTTGTTAGT CD62L            DREG-56        AHS0049    ATGGTAAATATGGGCGAATGCGGGTTGTGCTAAAGT CD272            J168-540       AHS0052    GTAGGTTGATAGTCGGCGATAGTGCGGTTGAAAGCT CD154            TRAP1          AHS0077    TAAGAGGTAAGTGCATTCGGGTATAGGCGTGATTTG CD357 (GITR)     V27-580        AHS0104    TCTGTGTGTCGGGTTGAATCGTAGTGAGTTAGCGTG CD28             L293           AHS0138    TTGTTGAGGATACGATGAAGCGGTTTAAGGGTGTGG TCRgd            11F2           AHS0142    CTCGTGGGTTAGGCTTGATCGTAGTTATGTATGGTT CD44             L178           AHS0167    GTGATTGATTAGGACAGTTCGTTGCTTAGTAGTGGG TCR Va24-Ja18    6B11           AHS0175    TTCTGGTTCGGTTGAGCTACTAATTTCGTTGGATGG CD161 (KLRB1)    HP-3G10        AHS0205    TTTAGGACGATTAGTTGTGCGGCATAGGAGGTGTTC CD8              SK1            AHS0228    AGGACATAGAGTAGGACGAGGTAGGCTTAAATTGCT CD3              UCHT1          AHS0231    AGCTAGGTGTTATCGGCAAGTTGTACGGTGAAGTCG CD197 (CCR7)     2-L1-A         AHS0273    AATGTGTGATCGGCAAAGGGTTCTCGGGTTAATATG TIGIT            tgMab-2        AHS0411    AGAGGGTTTAGTCAAGGTCGTGCGTATAGTTCAGGT List of all 30 Human AbSeq specificities included in the BD® OMICS-One B-Cell panel: ________________________________________________________________________________ Specificity      Clone          Oligo ID   BD® AbSeq Barcode Sequence CD20             2H7            AHS0008    TTGCTTGTTGCGCGTTAGAGAGTATGTCGGGAGATG CD275            2D3/B7-H2      AHS0011    GTTTATATGTACGACGCCCGGTTGACGAGTGGAAGT CD38             HIT2           AHS0022    GTCAACGATGGGTAGCGGTAGAAATAACGGAACTGG CD95             DX2            AHS0023    GGCCCGTTAGAGTTGGTATCCGTATGAAGGTTAGCT CD27             M-T271         AHS0025    TGTCCGGTTTAGCGAATTGGGTTGAGTCACGTAGGT CD19             SJ25C1         AHS0030    TAGTAATGTGTTCGTAGCCGGTAATAATCTTCGTGG HLA-DR           G46-6          AHS0035    TGTTGGTTATTCGTTAGTGCATCCGTTTGGGCGTGG CD185 (CXCR5)    RF8B2          AHS0039    AGGAAGGTCGATTGTATAACGCGGCATTGTAACGGC CD24             ML5            AHS0042    ACTTTGGGTTGAGCGCATGATTATTCGTGACACTTT CD80             L307.4         AHS0046    GAGGGTAACGGGTGTCCAAATATCGGCTGTGTAAGT CD5              UCHT2          AHS0047    ACGAAGCGAGCGAAGAACCTATGCGATTGAGTAAGT CD10             HI10a          AHS0051    CCTGTTTGATGCGTACGGAGATTTAGCGGATTTATG IgD              IA6-2          AHS0058    TGAGGGATGTATAGCGAGAATTGCGACCGTAGACTT IgG              G18-145        AHS0059    AGGTAGGTTATCGTAGGGTAGACTTAGCGGGCATTG CD184 (CXCR4)    12G5           AHS0060    CAGTGTTTAGAGCGGGTTGCATATGTCGTTTAGAGG CD34             581            AHS0061    TGGGTGTATTACGGTTAGTTTATGCGCGAAGGTGTT CD21             B-ly4          AHS0074    GTATTCGCGTATTGTCAGTCGGTAGGGTTATGGTCT CD9              M-L13          AHS0082    GGGTTGTAAGTCGTCGGAAGTGTGAAGCGTATAGTG CD126            M5             AHS0096    AATGGTGAATCGCCCTAGCAAGTGGTATCGGAATCG CD30             BERH8          AHS0114    CCAGTGTAGATTGAGCCGTCGATTTAGTTAGCAGTG CD40             5C3            AHS0117    GGTGTAATTGGGCTAGAACGTATATGCGGTAAGGCG CD138            MI15           AHS0121    TAAGCTGCCGGTATTGGAAACGTATCGATCTATTGG CD79B            CB3-1          AHS0153    CATCATGAGTAGTTGCTTCGGCGAGTAGGTTTAATT CD22             HIB22          AHS0195    TGGTTCGTGACTGTATAGGCTTAGCTTAGGCAATTT IgM              G20-127        AHS0198    TTTGGAGGGTAGCTAGTTGCAGTTCGTGGTCGTTTC CD43             1G10           AHS0200    ATGGCGGATGGATTTGTCGGTGATATTGCTCTCGTT CD268 (BAFF-R)   11C1           AHS0206    TGTGAATGAGTTAAGCGTCGCGGATATGTAGAGCCT CD23             EBVCS-5        AHS0210    TTTGATGTGGGCGGGTTGTATTACGGTTTCGAGTCT CD73             AD2            AHS0216    AAAGTAGGGTCGATCAAGGGAGTTAACGGTAGCGCT CD1d             CD1d42         AHS0219    GTTAGGATTATTGACGTACCGAGTTAGGAGTGATTG Both T-Cell and B-Cell Protein Panels contain the same CD95 antibody.
Product Notices: Product Notices This reagent is provided lyophilized in a pre-titrated format. Go tohttps://www.bdbiosciences.com/en-us/resources/protocols/single-cell-multiomicsfor additional BD Rhapsody™ protocols. Please refer to https://www.bdbiosciences.com/en-us/resources/protocols/single-cell-multiomics for technical protocols. Go to https://abseq-ref-gen.genomics.bd.com/to access AbSeq reference files in FASTA format for bioinformatics analyses. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing. Follow state and local guidelines when disposing of hazardous waste. Source of all serum proteins is from USDA inspected abattoirs located in the United States. For U.S. patents that may apply, see bd.com/patents. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924