Iright
BRAND / VENDOR: Biolegend

Biolegend, 303037, TotalSeq™-D0369 anti-human CD29 Antibody, 10μg

CATALOG NUMBER: 303037
Regular price$0.99
/
Shipping calculated at checkout.
  • ddddd

    99 xxxxxx

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD29 is a 130 kD single chain type I glycoprotein also known as integrin β 1 , VLA-β chain, or gpIIa. It is broadly expressed on a majority of hematopoietic and non-hematopoietic cells, including leukocytes (although at low level on granulocytes), platelets, fibroblasts, endothelial cells, epithelial cells, and mast cells. CD29 is a member of the integrin family. It is non-covalently associated with integrin α1-α6 chains to form VLA-1 to VLA-6 molecules, respectively. Integrins, which include CD29, bind to several cell surface (e.g. VCAM-1, MadCAM-1) and extracellular matrix molecules. CD29 acts as a fibronectin receptor and is involved in a variety of cell-cell and cell-matrix interactions.
10μg
Verified Reactivity: Human
Reported Reactivity: African Green, Baboon, Cow, Cynomolgus, Dog, Horse, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: immunoprecipitation3, immunohistochemical staining of acetone-fixed frozen tissue sections3,5, and activation of integrin ß14,7,8. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 303010). Clone TS2/16 recognizes epitope A2.10
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York. Gutierrez-Lopez M, et al. 2003. J. Biol. Chem. 278:208. Hemler ME, et al. 1984. J. Immunol. 132:3011. (IHC, IP) Sanchez-Aparicio P, et al. 1994. J. Cell Biol. 126:271. (Activ) Frank NY, et al. 2005. Cancer Res. 65:4320. (IHC) Murga M, et al. 2005. Blood 105:1992. (FC) PubMed Porter JC and Hogg N. 1997. J. Cell Biol. 138:1437. (Activ) Conway RE, et al. 2006. Mol. Cell. Biol. 26:5310. (Activ) Wesseling J, et al. 1995. J. Cell. Biol. 129:255. (Dog Reactivity) Rubio G, et al. 2002. Cancer Immunol. Immunother. 51:130. Dong A, et al. 2015. J Biol Chem. 290:8016. PubMed Paebst F, et al. 2014. Cytometry A. 85(8):678-87. (Horse reactivity)
RRID: AB_2941468 (BioLegend Cat. No. 303037)
Structure: Integrin, type I glycoprotein, forms VLA-1 to VLA-6 heterodimers with CD49a-f (α1-α6), also associates with CD51 (αV), and α7- α9, 130 kD
Distribution: Lymphocytes, monocytes, granulocytes (low), platelets, mast cells, fibroblasts, endothelial cells
Function: Cell-cell and cell-matrix interactions
Ligand/Receptor: VCAM-1, MAdCAM-1, ECM
Cell Type: Embryonic Stem Cells, Endothelial cells, Fibroblasts, Granulocytes, Lymphocytes, Mast cells, Mesenchymal Stem Cells, Monocytes, Platelets, Tregs
Biology Area: Cell Adhesion, Cell Biology, Immunology, Innate Immunity, Stem Cells
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Hemler M. 1990. Annu. Rev. Immunol. 8:365. 2. Hynes R. 1992. Cell 69:11.
Gene ID: 3688
UniProt: View information about CD29 on UniProt.org
Clone: TS2/16
Regulatory Status: RUO
Workshop: V A-S202
Other Names: Integrin β1 chain, VLA-β chain, gpIIa, ITGB1
Isotype: Mouse IgG1, κ
Barcode Sequence: GTATTCCCTCAGTCA


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924