Biolegend, 312625, TotalSeq™-D0592 anti-human CD158b/j (KIR2DL2/L3/S2) Antibody, 10μg

CD158b is expressed on natural killer cells and a subset of T cells. It is a member of the immunoglobulin superfamily containing two immunoglobulin C2-type domains. Both variants and alternative isoforms of CD158b have been reported. The interaction of CD158b with specific HLA-C antigens on a target cell (HLA-Cw1, HLA-Cw3, HLA-Cw7 alleles, for example) inhibits cytotoxicity and prevents target cell lysis and death. The interactions between KIR and MHC class I are thought to be important in NK cell and T cell regulation following antigen stimulation. The absence of ligands for KIRs may lower the threshold for activation through activating receptors and increase inflammation and susceptibility to autoimmune disease.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: The DX27 monoclonal antibody reacts with a common epitope of KIR2DL2 (CD158b1, p58.2), KIR2DL3 (CD158b2, p58.3), and KIR2DS2 (CD158j, p50.2). Additional reported applications (for the relevant formats) include: restoring the NK cell cytotoxicity1,5.This clone has been tested in-house and determined to not be suitable for applications in immunohistochemistry of paraffin-embedded tissue sections (IHC-P).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Bakker ABH, et al. 1998. J. Immunol. 160:5239. Lucas M, et al. 2003. J. Virol. 77:2251. Goodier M, et al. 2000. J. Immunol. 165:139. Yawata M, et al. 2002. Immunogenetics 54:543. Valiante NM, et al. 1997. Immunity 7:739.
RRID: AB_3675040 (BioLegend Cat. No. 312625)
Structure: Immunoglobulin superfamily member, contains two immunoglobulin C2-type domains, type I membrane protein
Distribution: NK cells and a subset of T cells
Function: Inhibits cytotoxic function of NK and T cells upon interacting with specific HLA-C antigens on target cell
Ligand/Receptor: HLA-C antigens such as HLA-Cw1, HLA-Cw3, HLA-Cw7
Cell Type: NK cells, T cells
Biology Area: Immunology
Molecular Family: CD Molecules
Antigen References: 1. Colonna M, et al. 1995. Science 268:405. 2. Uhrburg M, et al. 1997. Immunity 7:753. 3. Wagtmann N, et al. 1995. Immunity 3:801. 4. Dohring C, et al. 1996. Immunogenetics 44:227. 5. Maenaka K, et al. 1999. Structure 7:391.
Gene ID: 3803
UniProt: View information about CD158b/j on UniProt.org
Clone: DX27
Regulatory Status: RUO
Other Names: CD158b1 (KIR2DL2, p58.2), CD158b2 (KIR2DL3, p58.3), CD158j (KIR2DS2, p50.2), KIR-NKAT2, CD158b/CD158j
Isotype: Mouse IgG2a, κ
Barcode Sequence: GACCCGTAGTTTGAT