Biolegend, 316027, TotalSeq™-D0033 anti-human CD52 Antibody, 10μg

CD52, also known as Cambridge pathology antigen 1 (CAMPATH-1), is a 25-29 kD glycoprotein containing a large N-linked carbohydrate moiety. The actual molecule of CD52 is only 8-9 kD. It is expressed in the male reproductive tract and on virtually all lymphocytes (T and B cells), as well as macrophages/monocytes, eosinophils, and red cells. CD52 is thought to play a role in carrying and orienting carbohydrates. CD52 is a potent target for complement-mediated lysis and antibody-mediated cellular cytotoxicity and has been used as a depletion target for chronic lymphocytic leukemia (CLL)/lymphoma and immunosuppression. The HI186 antibody is useful for flow cytometry and immunohistochemistry.
10μg
Verified Reactivity: Human
Reported Reactivity: Cynomolgus, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human tonsil
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: immunohistochemical staining of formalin-fixed paraffin-embedded tissue sections.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London.
RRID: AB_2910388 (BioLegend Cat. No. 316027)
Structure: Unusually small glycopeptide containing N-linked carbohydrate moiety, GPI-linked membrane protein, approximate molecular weight 7 kD
Distribution: Male reproductive tract (epididymis, seminal vesicle), T cells, B cells, macrophage/monocyte, eosinophil, erythrocytes, malignant lymphocytes
Function: Thought to play a role in carrying and orienting carbohydrates. Target for complement-mediated lysis and antibody-dependent cellular cytotoxicity, used as a depletion target for chronic lymphocytic leukemia/lymphoma therapy and immunosuppression.
Cell Type: B cells, Eosinophils, Erythrocytes, Macrophages, Monocytes, T cells
Biology Area: Costimulatory Molecules, Immunology
Molecular Family: CD Molecules
Antigen References: Leukocyte Typing VI. Kishimoto T, et al. (Eds.) Garland Publishing Inc. (1997) Xia MQ, et al. 1991. Eur. J. Immunol. 21:1677. Kirchhoff C, et al. 1993. Mol. Reprod. Dev. 34:8. Xia MQ, et al. 1993. Biochem. J. 293:633.
Gene ID: 1043
UniProt: View information about CD52 on UniProt.org
Clone: HI186
Regulatory Status: RUO
Workshop: HCDM listed
Other Names: Cambridge pathology antigen 1 (CAMPATH-1), epididymal secretory protein 1
Isotype: Mouse IgG2a, κ
Barcode Sequence: CTTTGTACGAGCAAA