Product Description
CD72 is a 39-43 kD type II membrane glycoprotein. It is a disulfide-linked homodimer belonging to C-type lectin family. CD72 is a pan-B cell marker expressed on pre-pre-B cells throughout B cell differentiation with the exception of plasma cells. It is also expressed on follicular dendritic cells, splenic red pulp macrophages (but not on peripheral blood monocytes), and liver Kupffer cells. CD72, a negative coreceptor of B cells, contains immunoreceptor tyrosine-based inhibitory motifs in the cytoplasmic domain which has been shown to recruit the tyrosine phosphatase SHP-1. Ligation of CD72 with its ligand regulates CD72 tyrosine dephosphorylation and SHP-1 dissociation to promote B cell activation and proliferation. CD100 and CD5 have been shown to be CD72 ligands. The CD100-CD72 interaction plays a role in maintenance of B cell homeostasis.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human lymphocytes
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: immunoprecipitation.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Knapp W, et al. Eds. 1989. Leucocyte Typing IV. Oxford University Press. New York.
RRID: AB_2924532 (BioLegend Cat. No. 316215)
Structure: Type II membrane glycoprotein, C-type lectin family, 39-43 kD, homodimer
Distribution: Pre-pre-B cells throughout B cells differentiation (but not on plasma cells), follicular dendritic cells, splenic red pulp macrophages, liver Kupffer cells
Function: negative regulation of B cell receptor signaling
Ligand/Receptor: CD5, CD100/Sema4D
Cell Type: B cells, Dendritic cells
Biology Area: Immunology
Molecular Family: CD Molecules
Antigen References: Knapp W, et al. Eds. 1989. Leucocyte Typing IV. Oxford University Press. New York. Schwarting T, et al. 1992. Am. J. Hematol. 41:151. Wu HJ and S. Bondata. 2002. Immunol. Res. 25:155. Kumanogoh A, et al. 2000. Immunity 13:621. Parnes JR and C. Pan. 2000. Immunol. Rev. 176:75. Kumanogoh A, et al. 2005. Intnl. Immunol. 17:1277.
Gene ID: 971
UniProt: View information about CD72 on UniProt.org
Clone: 3F3
Regulatory Status: RUO
Workshop: VI CD72.1
Other Names: Lyb-2, Ly-19.2, Ly-32.2
Isotype: Mouse IgG2b, κ
Barcode Sequence: CAGTCGTGGTAGATA
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924