Iright
BRAND / VENDOR: Biolegend

Biolegend, 323517, TotalSeq™-D0128 anti-human CD140a (PDGFRα) Antibody, 10μg

CATALOG NUMBER: 323517
Regular price$0.99
/
Shipping calculated at checkout.
  • ddddd

    99 xxxxxx

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

The 16A1 monoclonal antibody recognizes human CD140a also known as the platelet-derived growth factor receptor, alpha polypeptide, PDGFR2, and PDGFRα. CD140a is a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. The identity of the growth factor bound to the receptor determines whether the functional receptor is a homodimer or heterodimer composed of both PDGFR-α and -β. CD140a contains three immunoglobulin-like domains and a tyrosine kinase domain with a predicted molecular weight of approximately 123 kD. CD140a is widely expressed on a variety of mesenchymal-derived cells and has been implicated in the development of some tumors including basal cell carcinoma and gastric stromal cell tumors. Binding of A-chain containing PDGF molecules as well as protease-activated PDGF-C molecules can stimulate cell proliferation. CD140a has been shown to interact with a number of proteins including CRK, Grb2, Grb14, SHP2, and others as integrin β3, caveolin-1, and nexin sorting molecules. The PDGFRα is heavily phosphorylated on numerous tyrosine residues through both autophosphorylation and ligand-dependent processes. The 16A1 antibody has been shown to be useful for flow cytometric detection of CD140a.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: NIH 3T3 cells transfected with human PDGFRalpha
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Miyazaki S et al. In:Leukocyte Typing VI Kishimoto et al. Eds, Garland Publishing Inc, New York 1998 pp 3-20. Lottaz C, et al. 2010. Cancer Res. 70:2030. PubMed Ricono JM, et al. 2009. Am. J. Physiol. Renal Physiol. 296:F406. (IF) Guarnerio J, et al. 2015. Cancer Discov. 5:396. PubMed
RRID: AB_2927874 (BioLegend Cat. No. 323517)
Structure: Cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family.
Distribution: Widely expressed on a variety of mesenchymal-derived cells.
Function: Stimulation of cell proliferation; mitogenic activity for cells of mesenchymal origin. Knock-out studies have implicated an essential role for CD140a in kidney development. Has been implicated in basal cell carcinoma and gastric stromal cell tumors.
Interaction: Interacts with Crk, as well as a variety of adaptor molecules and signaling intermediates (Grb2, Grb14, SHP2, others). Has also been shown to associate with integrin β3, caveolin-1, and nexin sorting molecules
Ligand/Receptor: Binds to A-chain containing PDGF molecules and protease-activated PDGF-C molecules
Modification: Multiple tyrosine phosphorylation sites (Y720, Y731, Y742, Y754, Y762, Y767, Y768, Y988, Y993, Y1018)
Cell Type: Embryonic Stem Cells, Mesenchymal cells, Mesenchymal Stem Cells, Neural Stem Cells
Biology Area: Angiogenesis, Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells
Molecular Family: CD Molecules, Cytokine/Chemokine Receptors
Antigen References: 1. Gronwald RG, et al. 1988. Proc. Natl. Acad. Sci. USA 85:3435. 2. Gilbertson DG, et al. 2001. J. Biol. Chem. 276:27406. 3. Seifert RA, et al. 1989. J. Biol. Chem. 264:8771. 4. Rupp E, et al. 1994. Eur. J. Biochem. 225:29.
Gene ID: 5156
UniProt: View information about CD140a on UniProt.org
Clone: 16A1
Regulatory Status: RUO
Other Names: Platelet-derived growth factor receptor, alpha polypeptide, PDGFR2, PDGFRα, PDGFRa, PDGF receptor alpha
Isotype: Mouse IgG1, κ
Barcode Sequence: ATGCGCCGAGAATTA


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924