Biolegend, 329541, TotalSeq™-D0189 anti-human CD244 (2B4) Antibody, 10μg

CD244, known as 2B4, is a 38 kD type I transmembrane protein. It is a member of the CD2 subset of the immunoglobulin superfamily (IgSF) molecules. CD244 is expressed on NK cells, a subset of T cells (including most CD8 + T cells and γ/δ T cells), monocytes, basophils, and eosinophils. CD48 is the ligand of CD244. It has been reported that ligation of human CD244 results in enhanced NK cell cytotoxicity and cytokine production. Recent studies have shown that human CD244, like murine CD244, has both activating and inhibitory functions, which are dependent on the density of surface 2B4 expression, degree of ligation, and the level of the adaptor molecule SAP expression.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: inducing cytokine production by NK cells, enhancing NK cytotoxicity, and Western blotting.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Valiante NM and Trinchieri G. 1993. J. Exp. Med. 178:1397. Chuang SS, et al. 2000. Immunology. 100:378. Hoffmann SC, et al. 2011. J. Immunol. 186:2757. PubMed Rossi LE, et al. 2012. J Leukoc Biol. 91:321. PubMed Correia DV, et al. 2011. Blood 118:992. (FC) PubMed
RRID: AB_2894670 (BioLegend Cat. No. 329541)
Structure: 38 kD type I transmembrane protein, CD2 family member, Ig superfamily
Distribution: NK, T subset, monocytes, basophils, and eosinophils
Function: Activation and inhibition of NK cell function
Ligand/Receptor: CD48
Cell Type: Basophils, Eosinophils, Monocytes, NK cells, T cells
Biology Area: Immunology
Molecular Family: CD Molecules
Antigen References: 1. Lee KM, et al. 2003. J. Immunol. 170:4881. 2. Chlewicki LK, et al. 2008. J. Immunol. 180:8159. 3. Messmer B, et al. 2006. J. Immunol. 176:4646. 4. Boles KS, et al. 2001. Immunol. Rev. 181:234.
Gene ID: 51744
UniProt: View information about CD244 on UniProt.org
Clone: C1.7
Regulatory Status: RUO
Workshop: VII 70350
Other Names: 2B4, SLAMF4
Isotype: Mouse IgG1, κ
Barcode Sequence: TCGCTTGGATGGTAG