Iright
BRAND / VENDOR: Biolegend

Biolegend, 338717, TotalSeq™-D1249 anti-human CD85d (ILT4) Antibody, 10μg

CATALOG NUMBER: 338717
Regular price$0.99
/
Shipping calculated at checkout.
  • ddddd

    99 xxxxxx

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD85 is a group of Ig superfamily tansmembrane glycoproteins called Ig-Like Transcripts (ILTs) or Leukocyte Immunoglobulin-like Receptors (LIRs). It is composed of both activating and inhibitory isoforms. The activating subset of ILTs is characterized by containing short cytoplasmic domains and positively charged arginine residues, while the inhibitory isoforms display long cytoplasmic tails containing ITIM motifs. CD85d is a 95kD inhibitory receptor, also known as ILT4, LIR2, or MIR10. ILT4 is expressed on the surface of monocytes/macrophages, and dendritic cells. ILT4 acts as an inhibitory receptor through recruitment of SHP-1 and SHP-2 protein tyrosine phosphatases. The ligands of ILT4 are HLA-A, -B and nonclassical MHC-I molecule HLA-G1.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Rat
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications include: negatively modulate myelomonocytic cells signaling. Enhance the binding of HLA-G tetramer to monocytes.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Colonna M, et al. 1998. J. Immunol. 160:3096 Allan DS. 1999. J. Exp. Med. 189:1149
RRID: AB_2936585 (BioLegend Cat. No. 338717)
Structure: ILT/LIR family, Ig superfamily, 95kD
Distribution: Monocytes/macrophages, dendritic cells
Ligand/Receptor: MHC class I molecules (HLA-A, -B) and nonclassic class I molecule HLA-G1
Cell Type: Dendritic cells, Macrophages, Monocytes
Biology Area: Immunology
Molecular Family: CD Molecules
Antigen References: Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules: The CD Markers Wiley-Liss A John Wiley & Sons Inc, Publication Shiroishi M, et al. 2003. Proc. Natl. Acad. Sci. 100:8856 Colonna M, et al. 1998. J. Immunol. 160:3096 Lichterfeld M, et al. 2007. J. Exp. Med. 204:2813
Gene ID: 10288
UniProt: View information about CD85d on UniProt.org
Clone: 42D1
Regulatory Status: RUO
Other Names: CD85, ILT4, MIR10, Leukocyte Immunoglobulin-Like Receptor subfamily B member 2 (LILRB2), Leukocyte Immunoglobulin-like Receptor 2 (LIR-2)
Isotype: Rat IgG2a, κ
Barcode Sequence: AACGACGTAGATAGG


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924