Iright
BRAND / VENDOR: Biolegend

Biolegend, 342119, TotalSeq™-D0920 anti-human CD82 Antibody, 10μg

CATALOG NUMBER: 342119
Regular price$0.99
/
Shipping calculated at checkout.
  • ddddd

    99 xxxxxx

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD82 is a 45-90 kD type III tetraspan membrane protein which is encoded by the KAI1 gene. A member of the 4-span transmembrane protein superfamily (TM4SF) CD82 forms a complex with CD37, CD53, CD81, ECM and MHC molecules. CD82 is expressed on monocytes, granulocytes, lymphocytes, epithelial cells, endothelial cells, and fibroblasts and plays a role in signal transduction and adhesion. It has been suggested CD82 functions as a tumor suppressor as loss of expression has been found to promote tumor metastasis.
10μg
Verified Reactivity: Human
Reported Reactivity: African Green, Baboon, Cynomolgus
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
RRID: AB_2936650 (BioLegend Cat. No. 342119)
Structure: Type III tetraspan membrane protein, 45-90 kD, complexed with CD37, CD53, CD81, ECM and MHC molecules, 4-span transmembrane protein superfamily (TM4SF)
Distribution: Monocytes, granulocytes,lymphocytes, epithelial cells, endothelial cells, fibroblasts
Function: Signal transduction, adhesion, tumor metastasis suppressor
Ligand/Receptor: KITENIN
Cell Type: Basophils, Endothelial cells, Epithelial cells, Granulocytes, Lymphocytes, Monocytes
Biology Area: Immunology
Molecular Family: CD Molecules
Antigen References: 1. Miranti CK. 2009. Cell. Signal. 21:196 2. Abe M, et al. 2008. 266:163 3. Lee JH et al. 2004. Cancer Res. 64:4235 4. Lagaudriere-Gesbert C, et al. 1997. J. Immunol. 158:2790
Gene ID: 3732
UniProt: View information about CD82 on UniProt.org
Clone: ASL-24
Regulatory Status: RUO
Other Names: KAI1, C33, R2, 4F9, IA4
Isotype: Mouse IgG1, κ
Barcode Sequence: TCCCACTTCCGCTTT


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924