Product Description
CD235a (Glycophorin A) is member of the glycophorin A family. It is a type I sialoglycoprotein with a molecular weight of 10 kD, present in the cell membrane as a homodimer. Glycophorin A is expressed by erythroid precursors and erythrocytes. It carries the antigen determinants for the MNS blood groups and has been proposed to be an inhibitor of hemagglutination and hemolysis. Glycophorin A binds siglec 5, the erythrocyte binding antigen (EBA-175) of P. falciparum and some viruses, including influenza virus and hepatitis A virus.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Mason D, et al. Eds. 2002. Leucocyte Typing VII:White Cell Differentiation Antigens. Oxford University Press. (FC)
RRID: AB_2904370 (BioLegend Cat. No. 349125)
Structure: Member of the glycophorin A family; type I protein with a molecular weight of 10 kD; present in the membrane as homodimer
Distribution: Erythrocytes and erythroid precursors
Function: Possible inhibitor of hemagglutination and hemolysis; carries the antigen determinants for the MNS blood groups
Ligand/Receptor: Siglec 5, erythrocyte binding antigen (EBA-175) of P. falciparum, receptor for the influenza virus, hepatitis A virus
Cell Type: Erythrocytes
Biology Area: Cell Adhesion, Cell Biology, Immunology
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Reid ME. 2009. Immunohematology 25:95. 2. Palacajornsuk P. 2006. Immunohematology 22:171. 3. Pasvol G. 2003. Trends Parasitol. 19:430. 4. Takakuwa Y. 2001. Curr. Opin. Hematol. 8:80.
Gene ID: 2993
UniProt: View information about CD235a on UniProt.org
Clone: HI264
Regulatory Status: RUO
Workshop: VII 70312
Other Names: PAS-2, Sialoglycoprotein alpha, MN sialoglycoprotein, Glycophorin A, GYPA
Isotype: Mouse IgG2a, κ
Barcode Sequence: AGAGTATGTATGGGA
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924