Product Description
CD99 is a type I single chain transmembrane protein devoid of N-linked glycosylation sites encoded by the pseudoautosomal gene MIC2. CD99 has an apparent molecular weight of 32 kD and is widely expressed on a variety of tissues. CD99 is highly expressed on thymocytes, T cells, and T cell leukemias and lymphomas. However, it is absent on some B cell lines, fetal B cells, eosinophils, granulocytes and the NK-cell line YT. CD99 is involved in spontaneous rosette formation with erythrocytes and may also be involved in other T-cell and hematopoietic cell adhesion pathways. CD99 has been reported to activate a caspase-independent death pathway in T cells under some conditions. CD99 interacts with a number of proteins including ferritin heavy chain 1, karyopherin beta 1, TRIP13, cyclophilin A, annexin II, and ubiquitin-conjugating enzyme E2H.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human thymus
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Waclavicek M, et al. 1998. J. Immunol. 161:4671. Pickl W, et al. 2001. J. Virol. 75:7175.
RRID: AB_2894604 (BioLegend Cat. No. 371325)
Structure: Surface glycoprotein, type I transmembrane protein, 32kD.
Distribution: T-cells, thymocytes, T-cell leukemias and lymphomas. It is absent on fetal B-cells, eosinophils, granulocytes, and NK cell line YT.
Function: Leukocyte migration, T-cell adhesion, T-cell death- caspase independent, and spontaneous rosette formation with erythrocytes.
Interaction: Annexin II, E2H, Ferritin heavy chain 1, karyopherin beta 1, and TRIP13.
Cell Type: Leukemia, T cells, Thymocytes
Biology Area: Immunology
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Gelin C, et al. 1989. EMBO. 8:3253. 2. Goodfellow PJ, et al. 1986. Science 234:740. 3. Pettersen RD, et al. 2001. J. Immunol. 166:4931.
Gene ID: 4267
UniProt: View information about CD99 on UniProt.org
Clone: 3B2/TA8
Regulatory Status: RUO
Other Names: CD99, MIC2, HBA71, MSK5X, E2 antigen
Isotype: Mouse IgG2a, κ
Barcode Sequence: ACCCGTCCCTAAGAA
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924