Iright
BRAND / VENDOR: Thermo Fisher

Thermo Fisher, SO118, T7 promoter Sequencing Primer, 20-mer

CATALOG NUMBER: SO118
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

Thermo Fisher, SO118, T7 promoter Sequencing Primer, 20-mer Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T7 RNA Polymarese promoter region. Primers are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the T7 RNA polymerase promoter sequence in common cloning vectors, such aspTZ19R, pTZ57R, and pBluescript IIPromoter sequences5'-d (TAATACGACTCACTATAGGG)-3'Related productsT3 promoter Sequencing Primer, 17-merSP6 promoter Sequencing Primer, 24-merT3 promoter Sequencing Primer, 24-merSP6 promoter Sequencing Primer, 18-merNotes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated.
For Use With (Application): Sequencing
Form: Liquid
Product Type: Sequencing Primer
Quantity: 10 μM
Shipping Condition: Dry Ice
Vector: pTZ19R, pTZ57R, pBluescript II
Concentration: 10 μM
Primer: T7
Promoter: SP6, T3, T7
Unit Size: 10 µM


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924