Iright
BRAND / VENDOR: BD

BD, 572310, BD® OMICS-One Tumor Protein Panel

CATALOG NUMBER: 572310
Regular price$0.99
/
Shipping calculated at checkout.
572310
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

Reactivity: Human (Tested in Development)
Application: Single Cell 3' Sequencing (Qualified)
Regulatory Status: RUO
Storage Buffer: Lyophilized powder containing BSA and ≤ 0.25% sodium azide.
Description: Description The BD® OMICS-One Tumor Protein Panel consists of 30 different specificities against major tumor markers in a single tube. Designed and optimized to work on the BD Rhapsody™ System, the Tumor Protein Panel is tested to work seamlessly alongside the BD Rhapsody™ Whole Transcriptome Analysis (WTA) Assay, Targeted mRNA Assay, BD® Single-Cell Multiplexing Kit (SMK), BD® Intracellular CITE-seq (IC-AbSeq) Assay, and BD Rhapsody™ TCR/BCR Next Multiomic Assay for human. The individual antibodies were each conjugated to an oligonucleotide that contains a specific antibody barcode sequence flanked by a polyA tail on the 3' end and a common PCR handle (PCR primer binding site) on the 5' end. All AbSeq barcode sequences were generated in-silico with minimal sequence similarity to the human genomes, have low predicted secondary structure, and have high Hamming distance within the BD antibody-oligo portfolio, to allow for sequencing error correction and unique mapping. The polyA tail of the oligonucleotide allows the barcode sequence to be captured by BD Rhapsody™ Enhanced Cell Capture Beads. The 5' PCR handle allows for efficient library generation for various sequencing platforms. Each individual antibody exists at an optimal concentration within the 30-plex to enable superior target and population resolution. The Tumor Protein Panel is designed with SMART technology. SMART technology helps lower sequencing cost while increasing data resolution by attenuating antibodies that target high-expressing primary markers and allowing reallocation of sequencing reads to markers expressed at lower levels. With SMART technology, markers low in expression can be quantified without having to do deeper sequencing and incurring high sequencing cost. The three specificities attenuated in the Tumor Protein Panel are CD44, HLA-ABC, and CD45.
Preparation And Storage: Preparation And Storage Store at 2-8°C and protected from prolonged exposure to light. Do not freeze.
Recommended Assay Procedures: Recommended Assay Procedures This reagent is provided lyophilized in a pre-titrated format. 1. Remove the BD® OMICS-One Tumor Protein Panel tube from the foil bag and bring up to room temperature for 5 minutes. 2. Make sure the pellet is located at the bottom of the tube. If not, briefly centrifuge to collect the contents at the tube bottom. 3. Add 35 µL of nuclease-free water to the bottom of the tube and allow antibodies to reconstitute for 5 minutes at room temperature. 4. Transfer the reconstituted antibodies on ice until the cells are ready for staining. Note: Reconstitute antibody immediately before cell staining. Prolonged incubation of reconstituted antibody may increase the non-specific background. 5. For BD® AbSeq Ab-Oligo drop-in of 60 plex or lower, prepare the BD® AbSeq labeling MasterMix in 1.5-mL LoBind tube on ice. Note: For drop-in with more than 60 plex, reach out to technical support for calculation. For sequential labeling with Sample Tags or no Sample Tags, prepare BD® AbSeq labeling MasterMix for drop-ins as follows: ____________________________________________________________________________________________ Component                           1 sample (µL)       1 sample +          2 samples + 30% overage (µL)    30% overage (µL) Per BD® AbSeq Ab-Oligo              2.0                 2.6                 5.2 Total of BD® AbSeq Ab-Oligo         2.0 × N*            2.6 × N             5.2 × N FBS † (catalog number 554656)        140 – (2.0 × N)     182 – (2.6 × N)     364 – (5.2 × N) Total                               140                 182                 364 For co-labeling with Sample Tags, prepare BD® AbSeq labeling MasterMix for drop-ins as follows: ____________________________________________________________________________________________ Component                           1 sample (µL)       1 sample +          2 samples + 30% overage (µL)    30% overage (µL) Per BD® AbSeq Ab-Oligo              2.0                 2.6                 5.2 Total of BD® AbSeq Ab-Oligo         2.0 × N*            2.6 × N             5.2 × N FBS † (catalog number 554656)        120 – (2.0 × N)     156 – (2.6 × N)     312 – (5.2 × N) Total                               120                 156                 312 *  N = number of drop-in antibodies. N = 0 if there are no drop-in antibodies. †  FBS = BD Pharmingen™ Stain Buffer. 6. Pipet-mix the BD® AbSeq labeling MasterMix for drop-ins. Briefly centrifuge to collect the contents at the bottom, and place back on ice. 7. For sequential labeling with Sample Tags or no Sample Tags, for each sample, add 140 µL BD® AbSeq labeling MasterMix of drop-ins to the tube containing 35 µL reconstituted Tumor Protein Panel solution to make a total volume of 175 µL. For co-labeling with Sample Tags, for each sample, add 120 µL BD® AbSeq labeling MasterMix of drop-ins and 20 µL Sample Tag to the tube containing 35 µL reconstituted Tumor Protein Panel solution to make a total volume of 175 µL. 8. Pipet-mix the mixture, briefly centrifuge to collect the contents at the tube bottom, and place back on ice. 9. Centrifuge cells at 400 × g for 5 minutes. If Fc Block is used, proceed to step 10. Otherwise, skip to step 11. 10. (Optional) For samples containing myeloid and B lymphocytes, BD Biosciences recommends blocking nonspecific Fc Receptor–mediated false-positive signals with Human BD Fc Block (Cat. No. 564220). a. To perform blocking, pipet the Fc Block MasterMix into a new 1.5-mL LoBind tube on ice: _________________________________________________________________________________ Component                           1 sample (µL)*    1 sample + 20% overage (µL) FBS† (catalog number 554656)        20.0              24.0 Fc Block‡ (catalog number 564220)   5.0               6.0 Total                               25.0              30.0 *  Sufficient for up to 1 million cells. To block more cells, adjust the volume. †  FBS = BD Pharmingen™ Stain Buffer. ‡ Fc Block =  BD Pharmingen™ Human BD Fc Block. b. Pipet-mix the Fc Block MasterMix and briefly centrifuge. Place on ice. c. Remove the supernatant from the cells without disturbing the pellet. d. Resuspend the cells in 25 µL of Fc Block MasterMix. e. Incubate the cells at room temperature (15°C to 25°C) for 10 minutes. f. Add 175 µL of BD® AbSeq labeling MasterMix from Step 8 into the cell suspension. Pipet-mix and proceed to Step 12. 11. Remove the supernatant from the cells without disturbing the pellet. Add 25 µL Stain Buffer (FBS) to the 175 µL of BD® AbSeq labeling MasterMix from Step 8 to make a total volume of 200 µL. Resuspend the cell pellet in 200 µL total volume. Pipet-mix. 12. Transfer the cells with BD® AbSeq labeling MasterMix into a new 5-mL polystyrene Falcon tube. 13. Stain the cells on ice for 30 minutes. 14. Add 3–4 mL Stain Buffer (FBS) to labelled cells and pipet-mix. 15. Centrifuge at 400 x g for 5 minutes. 16. Uncap the tube and invert to decant supernatant into biohazardous waste. Keep the tube inverted and gently blot on a lint-free wiper to remove residual supernatant from tube rim. 17. Repeat steps 14–16 twice more for a total of three washes. 18. Resuspend the final washed cell pellet in 620 µL cold Sample Buffer from the BD Rhapsody™ Enhanced Cartridge Reagent V3 (catalog number 667052) and proceed to single cell capture with on-cartridge washing described in substeps a–c. Refer to the BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252) or BD Rhapsody™ HT Xpress System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24253) for additional details. Note: Perform on-cartridge washing after cell settling (8-minute incubation) as follows: a. At the protocol section of "Loading cells in BD Rhapsody™ 8-Lane Cartridge", after cell load, incubate the cartridge in the dark at room temperature for 8 minutes. b. Place the cartridge on the BD Rhapsody™ HT Xpress and perform the following On-Cartridge Wash steps: _____________________________________________________________ Material to load        Volume (µL) 1 lane      Pipette Mode Air                     380                     Prime/Wash Cold Sample Buffer      380                     Prime/Wash Air                     380                     Prime/Wash Cold Sample Buffer      380                     Prime/Wash c. (Optional) Perform the scanner step: Cell Load Scan, if using BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252). No need for 8-minute delay before scanning. Warning: All biological specimens and materials are considered biohazardous. Handle as if capable of transmitting infection and dispose using proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves. List of all 30 Human AbSeq specificities included in the BD® OMICS-One Tumor panel: _____________________________________________________________________________ Specificity     Clone      Oligo ID     BD® AbSeq Barcode Sequence CD274 (PD-L1) MIH1       AHS0004      ATCGTAAGGCTCGTGGTTCGTAAGTAAGTTCGTATC CD279 (PD-1)    EH12.1     AHS0014      ATGGTAGTATCACGACGTAGTAGGGTAATTGGCAGT CD45            HI30       AHS0040      GTGCGAAATGGCGGAATGTTATCTGCGAATGTAGTC CD324 (E-cad)   67A4       AHS0041      GATATGAATGGGTTGCGGTGTAAAGTCGTAATGGTT CD24            ML5        AHS0042      ACTTTGGGTTGAGCGCATGATTATTCGTGACACTTT CD90            5E10       AHS0045      GACTATATGTACGGTGTTAATTCGGGATCCTGCGCT CD34            581        AHS0061      TGGGTGTATTACGGTTAGTTTATGCGCGAAGGTGTT CD117           YB5.B8     AHS0064      GGATTAGTTGTCGTTATAGGGAGTGCGTTCTTAGCG HLA-A,B,C       G46-2.6    AHS0066      GATATGCATGGCGAGTAGGTAGAACGAAGCTTAGGT CD54            HA58       AHS0076      AAGAGAATATATGCGTGCGTTGTTAAGGGAATGCGT CD29            MAR4       AHS0080      TGGTAAGGTGGTTGCGAGTAAGTAGCGGTGAGTTGT CD47            B6H12      AHS0087      TGTTAGGTTCGACGTATTATGTGTAGATCCGCAAGG CD326 (EpCam)   EBA-1      AHS0089      TTGAGCGTAAAGTTGCGTCCGGTAATTGAGTTGCGT CD66            B1.1/CD66  AHS0094      GTCTGCGCAAGGTAAGCTAAGTAACGAAAGGGATCT CD133           W6B3C1     AHS0103      TTTGGTATTGGCACGGTTTGTAGCGAGTTGACGGTC CD26            M-A261     AHS0109      TGTAGGTTGCGCGGTTATTAGGGTATTATCGATCTG CD155           TX24       AHS0111      GCGGTGGATCGATGGGTATAGTTGGTAATTTGCGTC CD146           P1H12      AHS0127      AGGTTATTTAGGTGACGGTTGTATTGACGAGAGAGG C-MET           3D6        AHS0132      AGCGTGAGTTGTCGGTAGTTAATTATCGGAGAGTTT ITGRN BTA 7     FIB504     AHS0158      TTTCAGTTTGGTCGCAGTTAAGGTATCGTATGGGTC CD44            L178       AHS0167      GTGATTGATTAGGACAGTTCGTTGCTTAGTAGTGGG PECAM1 (CD31)   WM59       AHS0170      CTAAGGGACGTAATTGAGTTTCGGTGATCGCAGTTT EphB2           2H9        AHS0176      TATTGCGGGTAGGATTTGTCTCGAAGCGTAGGTAGC Vista           MIH65.RMAB AHS0187      ATCAGGGAATCTCGGTAAGTTAAACGTGTATAGTGC PDPLN           LPMAB-17   AHS0192      TTTATGAGTATTACGTCTGTTGCGATTGTTGGCGGT NOTCH1          MHN1-519   AHS0214      CGTAGTAGGAGCGTGTTTCATCGGCATTATCGTTTG CD325 (n-Cad)   8C11       AHS0223      TAGGATGAGTTTCGTAAGTAAGGTAGTCGTATGGCT CD58            1C3        AHS0237      TTGGTGAGTATTGGTGCGTAGTATGCGGGATGTTTG EGFR            EGFR.1     AHS0241      ATATGATTGATGCGGGTTAGCCTACAGATTCGAGTT CD227 (MUC1)    HMFG2      AHS0247      AGTGCATGGTTAGTAGGTGTGAGTCGTTAGATATTC
Product Notices: Product Notices Please refer to www.bdbiosciences.com/us/s/resources for technical protocols. Source of all serum proteins is from USDA inspected abattoirs located in the United States. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots. Please refer to http://regdocs.bd.com to access safety data sheets (SDS). For U.S. patents that may apply, see bd.com/patents. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing. Follow state and local guidelines when disposing of hazardous waste. Go to https://abseq-ref-gen.genomics.bd.com/to access AbSeq reference files in FASTA format for bioinformatics analyses. This reagent is provided lyophilized in a pre-titrated format.


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924