Biolegend, 301735, TotalSeq™-D0364 anti-human CD13 Antibody, 10μg

CD13 is a 150-170 kD type II transmembrane glycoprotein also known as aminopeptidase N, APN, and gp150. This zinc metallopeptidase is expressed as a homodimer on granulocytes, myeloid progenitors, endothelial cells, epithelial cells and subset of granular lymphoid cells. It is not expressed on platelets or erythrocytes. CD13 is thought to be involved in the metabolism of many regulatory peptides and functions in antigen processing and the cleavage of chemokines such as MIP-1. CD13 serves as the cellular receptor for Coronavirus.
10μg
Verified Reactivity: Human
Reported Reactivity: Baboon, Chimpanzee, Cotton-topped Tamarin
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: inhibition of tumor-cell invasion and blocking of aminopeptidase activities2,3, and immunohistochemical staining of acetone-fixed frozen tissue sections5. WM15 does not recognize formalin-fixed or paraffin-embedded tissue sections5. The LEAF™ purified antibody (Endotoxin < 0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 301708). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 301723 and 301724) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin < 0.01 EU/µg).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press. New York. Saiki I, et al. 1993. Int J Cancer. 54:137. (Block) Rosenzwajg M, et al. 2000. Blood 95:453. (Block) Kawase M, et al. 2008. J Virol. 83:712. (Block) PubMed Di Matteo P, et al. 2011. J. Histochem. Cytochem. 59:47. (IHC)
RRID: AB_2892346 (BioLegend Cat. No. 301735)
Structure: Zinc metallopeptidase, type II integral membrane glycoprotein, 150-170 kD
Distribution: Granulocytes, monocytes, myeloid progenitors, endothelial and epithelial cells, granular lymphocyte subset
Function: Zinc-binding metalloproteinase, antigen processing, cleaves MIP-1 chemokine
Ligand/Receptor: Coronavirus receptor
Cell Type: Endothelial cells, Epithelial cells, Granulocytes, Hematopoietic stem and progenitors, Lymphocytes, Mesenchymal Stem Cells, Monocytes, Neutrophils
Biology Area: Immunology, Stem Cells
Molecular Family: CD Molecules
Antigen References: 1. Shipp M, et al. 1993. Blood 82:1052. 2. Larsen S, et al. 1996. J. Exp. Med. 184:183.
Gene ID: 290
UniProt: View information about CD13 on UniProt.org
Clone: WM15
Regulatory Status: RUO
Workshop: IV M44
Other Names: Aminopeptidase N, APN, gp150, ANPEP
Isotype: Mouse IgG1, κ
Barcode Sequence: TTTCAACGCCCTTTC