Iright
BRAND / VENDOR: Biolegend

Biolegend, 302729, TotalSeq™-D0396 anti-human CD26 Antibody, 10μg

CATALOG NUMBER: 302729
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • ddddd

    99 xxxxxx

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

CD26 is a 110 kD type II membrane protein also known as ADA-binding protein and dipeptidyl peptidase IV (DPPIV). It is a member of the peptidase and ectoenzyme family. CD26 is expressed on the membrane of mature thymocytes, T lymphocytes (upregulated upon activation), B cells, NK cells, and macrophages. CD26 cleaves off N-terminal X-Pro and X-Ala dipeptides from polypeptides. It plays an integral role as a costimulatory molecule in T cell activation. CD26 may interact with extracellular matrix proteins such as fibronectin or collagen, CD45 and ADA.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Press. London. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
RRID: AB_2922532 (BioLegend Cat. No. 302729)
Structure: Peptidases and ectoenzyme families, type II glycoprotein, 110 kD
Distribution: Thymocyte subset, memory T cells, B cells, NK cells, epithelial cells, macrophages
Function: Dipeptidyl peptidase, T cell costimulation, HIV entry
Ligand/Receptor: Adenosine-deaminase, collagen
Cell Type: B cells, Epithelial cells, Macrophages, NK cells, T cells, Thymocytes
Biology Area: Costimulatory Molecules, Immunology
Molecular Family: CD Molecules
Antigen References: 1. Kameoka J, et al. 1993. Science 261:466. 2. Dang N, et al. 1990. J. Exp. Med. 172:649.
Gene ID: 1803
UniProt: View information about CD26 on UniProt.org
Clone: BA5b
Regulatory Status: RUO
Workshop: VI N-L078
Other Names: ADA-binding protein, DPP IV ectoenzyme, EC 3.4.14.5, DPP4
Isotype: Mouse IgG2a, κ
Barcode Sequence: GGTGGCTAGATAATG


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924