Iright
BRAND / VENDOR: Biolegend

Biolegend, 303151, TotalSeq™-D0124 anti-human CD31 Antibody, 10μg

CATALOG NUMBER: 303151
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

CD31 is a 130-140 kD type I transmembrane glycoprotein also known as platelet endothelial cell adhesion molecule-1 (PECAM-1) or Endocam. It is expressed on monocytes, platelets, granulocytes, endothelial cells and lymphocyte subsets. CD31 has been reported to bind CD38 and be involved in wound healing, angiogenesis, and cellular migration in an inflammatory situation.
10μg
Verified Reactivity: Human, Cynomolgus, Rhesus
Reported Reactivity: African Green, Baboon
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Clone WM59 has been reported to recognize the D2 extracellular portion of CD31.Additional reported applications (for the relevant formats) include: immunofluorescence microscopy2, immunohistochemical staining of acetone-fixed frozen tissue sections8, blocking of platelet aggregation3, and spatial biology (IBEX)11,12. Clone WM59 is not recommended for immunohistochemical staining of formalin-fixed paraffin-embedded sections. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 303143 & 303144).The purified WM59 antibody is useful as a capture antibody for a sandwich ELISA assay, when used in conjunction with biotin anti-human CD31 antibody (Cat. No. 536604) antibody as the detection antibody.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dnaThe barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Schlossman S, et al. Eds. 1995. Leucocyte Typing V Oxford University Press. New York. Muczynski KA, et al. 2003. J. Am. Soc. Nephrol. 14:1336. (IF) Wu XW, et al. 1997. Arterioscl. Throm. Vas. 17:3154. (Block) Nagano M, et al. 2007. Blood 110:151. (FC) PubMed MacFadyen JR, et al. 2005. FEBS Lett. 579:2569. PubMed Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC) Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21. Wicki A, et al. 2012. Clin. Cancer Res. 18:454. (FC, IHC) PubMed Oeztuerk-Winder F, et al. 2012. EMBO J. 31:3431. (FC) PubMed Bushway ME, et al. 2014. Biol Reprod. 90(5): 110 (IF) PubMed Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID: AB_2922535 (BioLegend Cat. No. 303151)
Structure: Ig superfamily, type I transmembrane glycoprotein, 130-140 kD
Distribution: Monocytes, platelets, granulocytes, endothelial cells, lymphocyte subset
Function: Cell adhesion, signal transduction
Ligand/Receptor: CD38
Cell Type: Endothelial cells, Granulocytes, Lymphocytes, Monocytes, Neutrophils, Platelets
Biology Area: Angiogenesis, Cell Adhesion, Cell Biology, Immunology, Neuroinflammation, Neuroscience
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: DeLisser H, et al. 1994. Immunol. Today 15:490. Newman P, 1997. J. Clin. Invest. 99:3. Fawcett J, et al. 1995. J. Cell Biol. 128:1229.
Gene ID: 5175
UniProt: View information about CD31 on UniProt.org
Clone: WM59
Regulatory Status: RUO
Workshop: V P025
Other Names: PECAM-1, EndoCAM
Isotype: Mouse IgG1, κ
Barcode Sequence: ACCTTTATGCCACGG


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924