Iright
BRAND / VENDOR: Biolegend

Biolegend, 304265, TotalSeq™-D0087 anti-human CD45RO Antibody, 10μg

CATALOG NUMBER: 304265
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

CD45RO is a 180 kD single chain membrane glycoprotein. It is a splice variant of tyrosine phosphatase CD45, lacking the A, B, and C determinants. The CD45RO isoform is expressed on activated and memory T cells, some B cell subsets, activated monocytes/macrophages, and granulocytes. CD45RO enhances both T cell receptor and B cell receptor signaling mediated activation. CD45 and its isoforms non-covalently associate with lymphocyte phosphatase-associated phosphoprotein (LPAP) on T and B lymphocytes. CD45 has been reported to be associated with several other cell surface antigens including CD1, CD2, CD3, and CD4. CD45 has also been reported to bind galectin-1 and CD22. CD45 isoform expression can change in response to cytokines.
10μg
Verified Reactivity: Human
Reported Reactivity: Chimpanzee, Cynomolgus, Common Marmoset
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: IL-2 dependent T cell line, CA1
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: The UCHL1 antibody is commonly used in combination with antibodies against CD45RA to discern memory and naïve T cells. Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections5 and formalin-fixed paraffin-embedded tissue sections4, Western blotting2, and immunoprecipitation3. UCHL1 signal intensity may be reduced in the presence of True-Stain Monocyte Blocker™ (Cat. No. 426102). Clone S19021B is not impacted by Monocyte Blocker and is recommended as an alternative to UCHL1.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Knapp W, et al. Eds. 1989. Leucocyte Typing IV. Oxford University Press. New York. (FC) Ishii T, et al. 2001. P. Natl. Acad. Sci. USA 98:12138. (WB) Ponsford M, et al. 2001. Clin. Exp. Immunol. 124:315. (IP) Yamada M, et al. 1996. Stroke 27:1155. (IHC) Sakkas LI, et al. 1998. Clin. Diagn. Lab. Immunol. 5:430. (IHC) Baba N, et al. 2010. Int. Immunol. 22:237. PubMed Thakral D, et al. 2008. J. Immunol. 180:7431. (FC) PubMed Weiss L, et al. 2010. P. Natl. Acad. Sci. USA 107:10632. PubMed Wu YY, et al. 2007. Infect. Immun. 75:4357. PubMed Mozaffarian N, et al. 2008. Rheumatology 47:1335. PubMed Roque S, et al. 2007. J. Immunol. 178:8028. PubMed Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC) Smith SH, et al. 1986. Immunology 58:63. (Immunogen) Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
RRID: AB_2894611 (BioLegend Cat. No. 304265)
Structure: Tyrosine phosphatases, type I transmembrane, 180 kD (isoform of CD45 containing none of the A, B, or C determinants)
Distribution: Activated and memory T cells, B cell subsets, monocytes, macrophages, granulocytes
Function: Enhances TCR and BCR signaling
Ligand/Receptor: CD22
Cell Type: B cells, Granulocytes, Macrophages, Mesenchymal Stem Cells, Monocytes, T cells, Tregs
Biology Area: Cell Biology, Immunology, Inhibitory Molecules, Neuroscience, Neuroscience Cell Markers, Stem Cells
Molecular Family: CD Molecules
Antigen References: 1. Thomas M. 1989. Annu. Rev. Immunol. 7:339. 2. Trowbridge I, et al. 1994. Annu. Rev. Immunol. 12:85.
Gene ID: 5788
UniProt: View information about CD45RO on UniProt.org
Clone: UCHL1
Regulatory Status: RUO
Workshop: IV N31
Other Names: CD45RO
Isotype: Mouse IgG2a, κ
Barcode Sequence: CTCCGAATCATGTTG


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924