Product Description
CD80, also known as B7-1, B7, and BB1, is a 60 kD single chain type I glycoprotein belonging to the immunoglobulin superfamily. CD80 is expressed on activated B and T cells, macrophages, and dendritic cells. CD80 binds to CD28 and CD152 (CTLA-4). Along with CD86, CD80 plays a critical role in regulation of T cell activation. The interaction of CD80 with CD28 provides a potent costimulatory signal for T cell activation through the CD3 complex, while its interaction with CTLA-4 provides an inhibitory signal for T cell activation.
10μg
Verified Reactivity: Human
Reported Reactivity: Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: in vitro blocking of T cell activation, immunohistochemical staining of acetone-fixed frozen tissue sections2, immunoprecipitation, and Western blotting3. The Ultra-LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 305245 & 305246).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Kishimoto T, et al. Eds. 1997. Leucocyte Typing VI. Garland Publishing Inc. London. Battifora M. 1998. J. Clin. Endocr. Metab. 83:4130. (IHC) Van der Merwe PA, et al. 1997. J. Exp. Med. 185:3. (WB) Jayakumar A, et al. 2008. Infect. Immun. 76:2138. PubMed Schubert DA, et al. 2012. J. Exp Med. 209:335. PubMed Wen T, et al. 2014. J Immunol. 192:5481. PubMed
RRID: AB_2892361 (BioLegend Cat. No. 305249)
Structure: Ig superfamily, type I transmembrane glycoprotein, 60 kD
Distribution: Activated B cells and T cells, macrophages, and dendritic cells
Function: T cell costimulation
Ligand/Receptor: CD28, CD152 (CTLA-4)
Cell Type: B cells, Dendritic cells, Macrophages, T cells, Tregs
Biology Area: Cell Biology, Costimulatory Molecules, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family: CD Molecules, Immune Checkpoint Receptors
Antigen References: 1. Freeman G, et al. 1991. J. Exp. Med. 174:625. 2. Linsley P, et al. 1996. Immunity 4:535. 3. Linsley P, et al. 1991. J. Exp. Med. 174:561.
Gene ID: 941
UniProt: View information about CD80 on UniProt.org
Clone: 2D10
Regulatory Status: RUO
Workshop: VI CD80.1
Other Names: B7-1, B7, BB1
Isotype: Mouse IgG1, κ
Barcode Sequence: ACGAATCAATCTGTG
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924