Product Description
CD94 is a 43 kD type II transmembrane glycoprotein also known as KP43. CD94 belongs to the C-type lectin superfamily and is present as a covalently linked heterodimer with NKG2 on the cell surface. CD94 is expressed by NK cells, a subset of γδ T cells, and NKT cells. The CD94/NKG2A complex serves as an inhibitory receptor specific for HLA-class I molecules.
10μg
Verified Reactivity: Human
Reported Reactivity: African Green, Baboon, Cynomolgus
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: NK cell line
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: immunoprecipitation4, inhibition of NK cell-mediated lysis5, immunohistochemical staining of acetone-fixed frozen tissue sections, and spatial biology (IBEX)6,7.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Mizuki M, et al. 2000. Sarcoidosis Vasc. Diffuse Lung Dis. 17:54. Phillip J, et al. 1996. Immunity 5:163. Lazetic S, et al. 1996. J. Immunol. 157:4741. Lanier LL, et al. 1998. Immunity 8:693. Wooden SL, et al. 2005. J. Immunol. 175:1383. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID: AB_2941473 (BioLegend Cat. No. 305529)
Structure: C-type lectin, type II transmembrane glycoprotein, covalently associates with NKG2, 43 kD
Distribution: NK cells , T subset
Function: Inhibits NK function
Cell Type: NK cells, T cells
Biology Area: Immunology, Innate Immunity
Molecular Family: CD Molecules
Antigen References: 1. Lopez-Botet M, et al. 1997. Immunol. Rev. 155:165. 2. Moretta A, et al. 1997. Immunol. Rev. 155:105.
Gene ID: 3824
UniProt: View information about CD94 on UniProt.org
Clone: DX22
Regulatory Status: RUO
Other Names: KP43
Isotype: Mouse IgG1, κ
Barcode Sequence: CTTTCCGGTCCTACA
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924