Iright
BRAND / VENDOR: Biolegend

Biolegend, 307213, TotalSeq™-D1183 anti-human CD261 (DR4, TRAIL-R1) Antibody, 10μg

CATALOG NUMBER: 307213
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

DR4 is 56 kD member 10A of the TNFR superfamily (TNFRSF10A), also known as TRAIL-R1, Apo-2, and CD261. It is expressed at low levels by activated T cells and some tumors. After TRAIL engagement, DR4 (TRAIL-R1), through activation of NF-κB, induces apoptosis in the TRAIL ligated cell.
10μg
Verified Reactivity: Human
Reported Reactivity: African Green, Cynomolgus
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Extracellular domain of DR4-human IgG1 Fc fusion protein
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: The DJR1 antibody is useful for immunofluorescent staining and flow cytometric analysis of DR4/TRAIL-R1 receptor expression. For most successful immunofluorescent staining results, it may be important to maximize signal over background by using a relatively bright fluorochrome-antibody conjugate (Cat. No. 307206) or by using a high sensitivity, three-layer staining technique (e.g., including a biotinylated antibody or biotinylated anti-mouse IgG second step (Cat. No. 405303), followed by SAv-PE (Cat. No. 405204)).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Uno K, et al. 2003. Blood 101:3658. Sato K, et al. 2005. J. Immunol. 174:4025. Lundqvist A, et al. 2006. Cancer Res. 66:7317. PubMed Chen KF, et al. 2011. J Pharmacol Exp Ther. 337:155. PubMed Sonnemann J, et al. 2012. Cancer Biol Ther. 13:417. PubMed Chandrasekaran S, et al. 2014. PLoS One. 9:111487. PubMed
RRID: AB_2941476 (BioLegend Cat. No. 307213)
Structure: TNFR superfamily, 56 kD
Distribution: Activated T cells, tumor cells
Function: Induces apoptosis
Ligand/Receptor: TRAIL
Cell Type: T cells
Biology Area: Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Immunology
Molecular Family: CD Molecules, Cytokine/Chemokine Receptors
Antigen References: 1. Macfarlane M. 2003. Toxicol. Lett. 139:89. 2. Baetu T, et al. 2002. Cytokine Growth Factor Rev. 13:199. 3. Degli-Esposti M. 1999. J. Leukoc. Biol. 65:535.
Gene ID: 8797
UniProt: View information about CD261 on UniProt.org
Clone: DJR1
Regulatory Status: RUO
Workshop: HCDM listed
Other Names: TRAIL-R1, Apo-2, CD261, TNFRSF10A
Isotype: Mouse IgG1, κ
Barcode Sequence: GCCCTTCCTCATTTC


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924