Iright
BRAND / VENDOR: Biolegend

Biolegend, 310735, TotalSeq™-D0397 anti-human CD193 (CCR3) Antibody, 10μg

CATALOG NUMBER: 310735
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • ddddd

    99 xxxxxx

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

CD193, also known as CC-chemokine receptor 3 (CCR3), CC CKR3, MIP1-alpha receptor like-2, and eotaxin receptor, is a member of the G protein-coupled seven transmembrane receptors family. It binds to the CC chemokines eotaxin, eotaxin-2, and eotaxin-3 with high affinity. CCR3 has also been reported to bind RANTES, MCP-3, and MCP-4 with low affinity. CCR3 receptor is expressed on human eosinophils, basophils, mast cells, mononuclear phagocytes, platelets, CD34 + hematopoietic progenitor cells, Th2-like lymphocytes, and keratinocytes. CCR3 is thought to play a role in allergic diseases such as bronchial asthma and allergic rhinitis. CCR3 is a co-receptor for HIV-1 and HIV-2, and the binding of eotaxin with CCR3 has been shown to inhibit HIV infection in some cell types.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: The 5E8 antibody is useful for immunofluorescent staining and flow cytometric analysis of CCR3 expression. It has been observed that the 5E8 antibody clone can interact with PE/Cyanine7 antibody conjugates during multi-color staining, potentially leading to unwanted staining. This interaction can be resolved by sequentially staining with the 5E8 antibody first and then followed by the PE/Cyanine7 conjugate of interest.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Beauvillian C, et al. 2011. Blood 117:1196. PubMed
RRID: AB_2904338 (BioLegend Cat. No. 310735)
Structure: G-protein coupled seven transmembrane domain receptor, 356 amino acids
Distribution: Eosinophils, basophils, mast, mononuclear phagocytes, platelets, CD34+ hematopoietic progenitor, Th2, keratinocytes
Function: Co-receptor for HIV-1 and HIV-2, allergy
Receptors: Eotaxin, eotaxin-2, eotaxin-3
Cell Type: Eosinophils, Erythrocytes, Hematopoietic stem and progenitors, Macrophages, Mast cells, Thymocytes
Biology Area: Immunology
Molecular Family: CD Molecules, Cytokine/Chemokine Receptors, GPCR
Antigen References: 1. Gerard W, et al. 1996. J. Exp. Med. 183:2437. 2. Uguccioni C, et al. 1997. J. Clin. Invest. 100:1137. 3. Sallusto F, et al. 1997. Science. 277:2005. 4. Loetscher P, et al. 2001. J. Biol. Chem. 276:2986.
Regulation: Upregulated by high affinity Fc IgE receptor ligation (mast cells), RANTES (keratinocytes), IFNg (monocytes, neutrophils), HIV tat protein (basophils), IL-3, IL-5 and GM-CSF (CD34+ progenitor cells), IL-2 and IL-4(T cells). Downregulated by IL-
Gene ID: 1232
UniProt: View information about CD193 on UniProt.org
Clone: 5E8
Regulatory Status: RUO
Other Names: CC CKR3, MIP1-alpha receptor like-2, eotaxin receptor, CD193, CCR3
Isotype: Mouse IgG2b, κ
Barcode Sequence: ACCAATCCTTTCGTC
Q: Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?
A: Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924