Iright
BRAND / VENDOR: Biolegend

Biolegend, 313561, TotalSeq™-D0171 anti-human/mouse/rat CD278 (ICOS) Antibody, 10μg

CATALOG NUMBER: 313561
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

ICOS, also known as inducible costimulatory molecule and H4, is a 47-57 kD protein. This protein is homologous to the CD28/CTLA-4 proteins. ICOS is expressed on activated T cells and a subset of thymocytes. It is able to costimulate T cells proliferation. In addition, ICOS is involved in humoral immune responses (B cell germinal center formation). The ICOS ligand is B7h/B7RP-1 or B7-H2. ICOS stimulation has been shown to potentiate TCR-mediated IL-4 and IL-10 production and has been proposed to play a role in Th2 cell development.
10μg
Verified Reactivity: Human, Mouse, Rat
Reported Reactivity: African Green, Baboon, Cynomolgus, Rhesus, Pig
Antibody Type: Monoclonal
Host Species: Armenian Hamster
Immunogen: Mouse T cell clone D10.G4.1
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: The C398.4A antibody is useful for flow cytometric analysis and is able to costimulate T cell activation and proliferation. Additional reported applications (for the relevant formats) include: immunoprecipitation1, in vitro costimulation of T cell activation1,3,4, and spatial biology (IBEX)5,6. The LEAF™ purified antibody (Endotoxin < 0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 313512).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Redoglia V, et al. 1996. Eur. J. Immunol. 26:2781. (FC IP Costim) Yagi J, et al. 2003. J. Immunol. 171:783. (FC) Arimura Y, et al. 2002. Int. Immunol. 14:555. (Costim) Arimura Y, et al. 2004. J. Biol. Chem. 279:11408. (Costim) Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID: AB_2894687 (BioLegend Cat. No. 313561)
Structure: CD28/CTLA-4, 47-57 kD
Distribution: Activated T cells, subset of thymocytes
Function: Costimulates T cell activation, proliferation, humoral immune response
Ligand/Receptor: B7h/B7RP-1/GL-50
Cell Type: T cells, Thymocytes, Tregs
Biology Area: Costimulatory Molecules, Immunology
Molecular Family: CD Molecules
Antigen References: 1. Redoglia V, et al. 1996. Eur. J. Immunol. 26:2781. 2. Hutloff A, et al. 1999. Nature 397:263. 3. Buonfiglio D, et al. 2000. Eur. J. Immunol. 30:3463. 4. Coyle AJ, et al. 2000. Immunity 13:95.
Gene ID: 1000488412985164545
UniProt: View information about CD278 on UniProt.org
Clone: C398.4A
Regulatory Status: RUO
Other Names: Inducible COStimulatory molecule, H4
Isotype: Armenian Hamster IgG
Barcode Sequence: CGCGCACCCATTAAA


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924