Iright
BRAND / VENDOR: Biolegend

Biolegend, 316637, TotalSeq™-D0898 anti-human Ig light chain λ Antibody, 10μg

CATALOG NUMBER: 316637
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • ddddd

    99 xxxxxx

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

The MHL-38 antibody reacts with both soluble and membrane human immunoglobulin light chain lambda (λ). It does not react with human immunoglobulin light chain kappa (κ) or heavy chains. The MHL-38 antibody can be used as primary or secondary reagent for immunofluorescent staining or ELISA analysis.
10μg
Verified Reactivity: Human
Reported Reactivity: Baboon, Cynomolgus, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human Ig cocktail
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Clone MHL-38 is not compatible with Human TruStain FcX (Fc Receptor Blocking Solution) (Cat. No. 422301 & 422302).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
RRID: AB_2922550 (BioLegend Cat. No. 316637)
Structure: Ig family
Distribution: B cells
Cell Type: B cells
Biology Area: Immunology
Gene ID: 3535
UniProt: View information about Ig light chain lambda on UniProt.org
Clone: MHL-38
Regulatory Status: RUO
Other Names: Immunoglobulin light chain lambda
Isotype: Mouse IgG2a, κ
Barcode Sequence: CAGCCAGTAAGTCAC


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924