Biolegend, 320923, TotalSeq™-D0919 anti-human MICA/MICB Antibody, 10μg

6D4 antibody reacts with a common epitope of the human nonclassical MHC class I chain-related protein A (MICA) and B (MICB), also known as PERB11.1 and PERB11.2. The MIC gene is located in MHC class I region. MICA/B are 65-75 kD stress-inducible glycoproteins with highly polymorphic. They are MHC class I-like transmembrane molecules that do not associate β2-microglobulin and do not present peptides. MICA and MICB share 85% identify, and are mainly expressed on Intestinal epithelial cells, epithelial tumor cells, endothelial cells, fibroblasts, and IFN-α-stimulated dendritic cells. MIC molecules bind NKG2D, an activating receptor, and induce activation of NK cells, and subset of CD8 + α/β T cells and γ/δ T cells, as well as suppression of T cell proliferation. MICA/B recognition is involved in the regulation of tumor surveillance, viral infection and autoimmune diseases. The 6D4 antibody is able to block MIC mediated cytotoxicity.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported (for the relevant formats) applications include: immunohistochemistry2,3,5 of acetone-fixed frozen sections and formalin-fixed paraffin-embedded tissue sections, immunoprecipitation7, and blocking2,3 of MIC mediated cytotoxicity. The Ultra-LEAF™ Purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 320919 & 320120).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Groh V, et al. 1999. Science 279:1737. Groh V, et al. 1999. Proc. Natl. Acad. Sci. USA. 96:6879. Groh V, et al. 2001. Nature Immunol. 2:255. Li Z, et al. 2000. Immunogenetics 51:246. Park EJ, et al. 2003. J. Immunol. 171:4131. Jinushi M, et al. 2003. J. Immunol. 171:5423. Wu J, et al. 2003. J. Immunol. 170:4196.
RRID: AB_2894688 (BioLegend Cat. No. 320923)
Structure: 65-75 kD glycoprotein, MHC class I-like transmembrane molecules that do not associate ß2-microglobulin, highly polymorphic
Distribution: Intestinal epithelium, epithelial tumors, endothelial cells, fibroblasts, INF-a-stimulated dendritic cells
Function: Activation of NK cells, subset of CD8+ α/ß T cells and γ/δ T cells, suppression of T cell proliferation
Ligand/Receptor: NKG2D
Cell Type: Dendritic cells, Endothelial cells, Epithelial cells, Fibroblasts
Biology Area: Immunology, Innate Immunity
Molecular Family: MHC Antigens
Antigen References: 1. Groh V, et al. 1996. Proc. Natl. Acad. Sci. USA. 93:12445. 2. Groh V, et al. 1999. Proc. Natl. Acad. Sci. USA. 96:6879. 3. Jinushi M, et al. 2003. J. Immunol. 170:1249. 4. Kriegeskorte AK, et al. 2005. Proc. Natl. Acad. Sci. USA. 102:11805. 5. Groh V, et al. 1999. Science 279:1737.
Gene ID: 1005074364277
UniProt: View information about MICA MICB on UniProt.org
Clone: 6D4
Regulatory Status: RUO
Other Names: PERB11, MIC, MHC class I chain-related protein A, MICA, PERB11.1, MHC class I chain-related protein B, MICB, PERB11.2
Isotype: Mouse IgG2a, κ
Barcode Sequence: CCCGCAGTATAACGA