Iright
BRAND / VENDOR: Biolegend

Biolegend, 323231, TotalSeq™-D0068 anti-human CD105 Antibody, 10μg

CATALOG NUMBER: 323231
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

CD105 is also known as Endoglin. It is a type I integral membrane homodimer protein with subunits of 90 kD found on vascular endothelial cells and syncytiotrophoblasts of placenta. CD105 is weakly expressed on stromal fibroblasts. It is also expressed on activated monocytes and tissue macrophages. Expression of CD105 is increased on activated endothelium in tissues undergoing angiogenesis, such as in tumors, or in cases of wound healing or dermal inflammation. CD105 is a component of the TGF-β receptor system in human umbilical vein endothelial cells and binds TGF-β1 and β3 with high affinity but does not bind to TGF-β2.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: L-cells transfected with human CD105
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Bühring HJ, et al. 1991. Leukemia 5:841. Vogel W, et al. 2002. Haematologica 88:126. Osaka M, et al. 2011. Brain Res. 9:1343. PubMed HonMou O, et al. 2011. Brain. 134:1790. PubMed Herrera MB, et al. 2013. Hepatology. 57:311. PubMed Iohara K, et al. 2014. Exp Gerontol. 52:39. PubMed
RRID: AB_2936590 (BioLegend Cat. No. 323231)
Structure: Associates with TGF-ß receptor I and II, homodimeric type I integral membrane protein, 90 kD
Distribution: Endothelial cells, activated monocytes/macrophages, bone marrow stromal cells, hematopoietic stem/progenitor cells
Function: Modulates cellular response to TGF-ß, involved in vascular development and remodelling
Ligand/Receptor: TGF-ß1, TGF-ß3
Cell Type: Endothelial cells, Hematopoietic stem and progenitors, Macrophages, Mesenchymal Stem Cells, Monocytes
Biology Area: Angiogenesis, Cell Biology, Immunology, Stem Cells
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Mason D, et al. Eds. 2002. Leucocyte Typing VII. Oxford University Press. New York. 2. Pierelli L, et al. 2001. Leuk. Lymphoma 42:1195.
Gene ID: 2022
UniProt: View information about CD105 on UniProt.org
Clone: 43A3
Regulatory Status: RUO
Other Names: Endoglin
Isotype: Mouse IgG1, κ
Barcode Sequence: ATCGTCGAGAGCTAG


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924