Iright
BRAND / VENDOR: Biolegend

Biolegend, 323613, TotalSeq™-D0129 anti-human CD140b (PDGFRβ) Antibody, 10μg

CATALOG NUMBER: 323613
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

CD140b is a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. The identity of the growth factor bound to the receptor determines whether the functional receptor is a homodimer or heterodimer composed of both PDGFR-α and -β. CD140b contains two immunoglobulin-like domains and a tyrosine kinase domain with a predicted molecular weight approximately 124 kD. CD140b is widely expressed on a variety of mesenchymal-derived cells and is preferentially expressed on some tumors such as medulloblastoma. Binding of B-chain containing PDGF molecules can stimulate cell proliferation. CD140b has been shown to interact with a number of kinases (including Raf-1, NCK1, FAK, Fyn, others) as well as adaptor molecules and signaling intermediates (Crk, Grb2, Grb4, RasGAP, SHP2, SHC1, others), and has also been shown to associate with integrin β3 and nexin sorting molecules. CD140b has been implicated in several disease states including atherogenesis and oncogenesis. The PDGFRβ is heavily phosphorylated on numerous tyrosine residues through both autophosphorylation and ligand-dependent processes.
10μg
Verified Reactivity: Human
Reported Reactivity: African Green, Baboon, Cynomolgus, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: NIH-3T3 cells transfected with human PDGFRbeta
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: The 18A2 monclonal antibody recognizes human CD140b also known as the platelet-derived growth factor receptor, beta polypeptide, PDGFR1, and PDGFRß. It has been shown to be useful for flow cytometric detection of CD140b.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Vogel W, et al. 2002. Haematologica 88:126. Arima, S., et al 2011. Development. 138:4763. PubMed.
RRID: AB_2941491 (BioLegend Cat. No. 323613)
Structure: Cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. The identity of the growth factor bound to the receptor determines whether the functional receptor is a homodimer or heterodimer composed of both PDGFR1 and PD
Distribution: Widely expressed on a variety of mesenchymal-derived cells. Preferentially expressed in medulloblastoma.
Function: Stimulation of cell proliferation; mitogenic activity for cells of mesenchymal origin. Has been implicated in atherogenesis and oncogenesis.
Interaction: Interacts with a number of kinases (including Raf-1, NCK1, FAK, Fyn, others) as well as adaptor molecules and signaling intermediates (Grb2, Grb4, RasGAP, SHP2, SHC1, Crk, others). Has also been shown to associate with integrin β3 and nexin sorting m
Ligand/Receptor: Binds to B-chain containing PDGF molecules as well as protease-activated PDGF-C
Modification: Multiple tyrosine phosphorylation sites (Y549, Y581, Y716, Y740, Y751, Y763, Y771, Y775, Y857, Y1009, Y1021)
Cell Type: Embryonic Stem Cells, Mesenchymal cells, Mesenchymal Stem Cells
Biology Area: Angiogenesis, Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells
Molecular Family: CD Molecules, Cytokine/Chemokine Receptors
Antigen References: 1. Claesson-Welsh L, et al. 1988. Mol. Cell Biol. 8:3476. 2. Gronwald RG, et al. 1988. Proc. Natl. Acad. Sci. USA 85:3435. 3. Gilbertson DG, et al. 2001. J. Biol. Chem.276:27406. 4. Seifert RA, et al. 1989. J. Biol. Chem. 264:8771. 5. Kanakaraj P, et al. 1991. Biochemistry 30:1761.
Gene ID: 5159
UniProt: View information about CD140b on UniProt.org
Clone: 18A2
Regulatory Status: RUO
Other Names: Platelet-derived growth factor receptor, beta polypeptide, PDGFR1, PDGFRβ, PDGFRb, PDGF receptor beta
Isotype: Mouse IgG1, κ
Barcode Sequence: CAATGGTTCACTGCC


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924