Iright
BRAND / VENDOR: Biolegend

Biolegend, 329969, TotalSeq™-D0088 anti-human CD279 (PD-1) Antibody, 10μg

CATALOG NUMBER: 329969
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

Programmed cell death 1 (PD-1), also known as CD279, is a 55 kD member of the immunoglobulin superfamily. CD279 contains the immunoreceptor tyrosine-based inhibitory motif (ITIM) in the cytoplasmic region and plays a key role in peripheral tolerance and autoimmune disease. CD279 is expressed predominantly on activated T cells, B cells, and myeloid cells. PD-L1 (B7-H1) and PD-L2 (B7-DC) are ligands of CD279 (PD-1) and are members of the B7 gene family. Evidence suggests overlapping functions for these two PD-1 ligands and their constitutive expression on some normal tissues and upregulation on activated antigen-presenting cells. Interaction of CD279 ligands results in inhibition of T cell proliferation and cytokine secretion.
10μg
Verified Reactivity: Human
Reported Reactivity: African Green, Baboon, Chimpanzee, Common Marmoset, Cynomolgus, Rhesus, Squirrel Monkey
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: blocking of ligand binding1-3, immunohistochemical staining of paraformaldehyde fixed frozen sections13, and spatial biology (IBEX)15,16. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 329911 and 329912). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 329926) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin <0.01 EU/µg).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Dorfman DM, et al. 2006 Am. J. Surg. Pathol. 30:802. (FA) Radziewicz H, et al. 2007. J. Virol. 81:2545. (FA) Velu V, et al. 2007. J. Virol. 81:5819. (FA) Zahn RC, et al. 2008. J. Virol. 82:11577. PubMed Chang WS, et al. 2008. J. Immunol. 181:6707. (FC) PubMed Nakamoto N, et al. 2009. PLoS Pathog. 5:e1000313. (FA) Jones RB, et al. 2009. J. Virol. 83:8722. (FC) PubMed Vojnov L, et al. 2010. J. Virol. 84:753. (FC) PubMed Radziewicz H, et al. 2010. J. Immunol. 184:2410. (FC) PubMed Monteriro P, et al. 2011. J. Immunol. 186:4618. PubMed Conrad J, et al. 2011. J. Immunol. 186:6871. PubMed Salisch NC, et al. 2010. J. Immunol. 184:476. (Rhesus reactivity) Li H and Pauza CD. 2015. Eur. J. Immunol. 45:298. (IHC) Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG) Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID: AB_2894607 (BioLegend Cat. No. 329969)
Structure: Immunoglobulin superfamily
Distribution: Transiently expressed on CD4- CD8- thymocytes; upregulated in thymocytes and splenic T and B lymphocytes; expressed on activated myeloid cells
Ligand/Receptor: B7-H1 (also known as PD-L1) and B7-DC (PD-L2)
Cell Type: B cells, Lymphocytes, T cells, Thymocytes, Tregs
Biology Area: Cancer Biomarkers, Immunology, Inhibitory Molecules
Molecular Family: CD Molecules, Immune Checkpoint Receptors
Gene ID: 5133
UniProt: View information about CD279 on UniProt.org
Clone: EH12.2H7
Regulatory Status: RUO
Other Names: PD-1, PDCD1
Isotype: Mouse IgG1, κ
Barcode Sequence: ACAGCGCCGTATTTA


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924