Iright
BRAND / VENDOR: Biolegend

Biolegend, 330929, TotalSeq™-D0174 anti-human CD58 (LFA-3) Antibody, 10μg

CATALOG NUMBER: 330929
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

CD58, also known as lymphocyte function-associated antigen 3 (LFA-3) is a 45-70 kD cell surface protein that is a member of the immunoglobulin superfamily. Alternative splicing of CD58 gives rise to transmembrane and glycosylphosphatidylinositol (GPI)-anchored forms on cell surface. CD58 is expressed on both hematopoietic and non-hematopoietic cells including B cells, T cells, monocytes, erythrocytes, endothelial cells, epithelial cells, and fibroblasts. High levels are observed on memory T cells and dendritic cells. CD58 expressed on antigen presenting cells and target cells enhances T cell recognition via the binding of it's cognate ligand, CD2, on the T cell surface.
10μg
Verified Reactivity: Human
Reported Reactivity: African Green, Baboon, Cynomolgus, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human cytolytic T cells
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications include: immunoprecipitation1, inhibition of cytolytic activity1, augment of IL-1 release by TE cells2
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dnaThe barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Sanchez-Madrid F, et al. 1982. Proc. Nati Acad. Sci. USA. 79:7489 Le PT, et al. 1990. J. Immunol. 144:4541
RRID: AB_2910395 (BioLegend Cat. No. 330929)
Structure: Immunoglobulin superfamily member, 45-70 kD cell surface protein. Alternative splicing gives rise to transmembrane and glycosylphosphatidylinositol (GPI)-anchored form on cell surface.
Distribution: Expressed on both hematopoietic and non-hematopoietic cells including B cells, T cells, monocytes, erythrocytes, endothelial cells, epithelial cells, and fibroblasts. High levels are observed on memory T cells and dendritic cells.
Function: Mediates adhesion between various cell types (target cells and cytotoxic cells, APC and T cells, thymocytes and thymic epithelia).
Ligand/Receptor: CD2
Cell Type: B cells, Dendritic cells
Biology Area: Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology
Molecular Family: CD Molecules
Antigen References: 1. Springer TA, et al. 1987. Annu. Rev. Immunol. 5:223. 2. Dustin ML, et al. 1987. Nature 329:846. 3. Arulanandam AR, et al. 1994. J. Exp. Med. 180:1861. 4. Sanders ME, et al. 1988. J. Immunol. 140:1401.
Gene ID: 965
UniProt: View information about CD58 on UniProt.org
Clone: TS2/9
Regulatory Status: RUO
Other Names: Lymphocyte function-associated antigen 3, LFA-3
Isotype: Mouse IgG1, κ
Barcode Sequence: GTTCCTATGGACGAC


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924