Iright
BRAND / VENDOR: Biolegend

Biolegend, 331241, TotalSeq™-D0139 anti-human TCR γ/δ Antibody, 10μg

CATALOG NUMBER: 331241
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

T cell receptor (TCR) is a heterodimer consisting of an α and a β chain (TCR α/β) or a γ and a δ chain (TCR γ/δ). TCR γ/δ is involved in the recognition of certain bacterial, self-CD1 molecule, and tumor antigens bound to MHC class I. The γ/δ TCR associates with CD3 and is expressed on a subset of T cells found in the thymus, the intestinal epithelium, and the peripheral lymphoid tissues and peritoneum. Most γ/δ T cells are CD4 - /CD8 - , some are CD8 + . T cells expressing the γ/δ TCR have been shown to play a role in oral tolerance, innate immune response for some tumor cells, and autoimmune disease. It has been reported that γ/δ T cells also play a principal role in antigen presentation.
10μg
Verified Reactivity: Human, Cynomolgus, Rhesus
Reported Reactivity: African Green, Baboon, Pigtailed Macaque
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Clone B1 is also known as clone B1.1.Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections3 and paraffin-embedded sections5, in vitro blocking, and spatial biology (IBEX)8,9. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for highly sensitive assays (Cat. Nos. 331235 and 331236).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Rodriguez-Gago M, et al. 2001. Transplantation. 72:503. Lehmann FS, et al. 2002. Am. J. Physiol. Gastrointest. Liver. Physiol. 283:G481. (FC) Bordignon M, et al. 2008. Mol. Med. Rep. 1:485. (IHC) Conrad M, et al. 2007. Cytom. Part A 71A:925. (FC) Pollinger B, et al. 2011. J. Immunol. 186:2602. (IHC) Correia DV, et al. 2011. Blood. 118:992. (Block) Laurent AJ, et al. 2014. PLoS One. 9:103683. PubMed Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID: AB_2892399 (BioLegend Cat. No. 331241)
Structure: Ig superfamily, associates with CD3 complex
Distribution: T subset in thymus, intestinal epithelium, peripheral lymphoid tissues and peritoneum
Function: Antigen recognition
Ligand/Receptor: Some bacterial or tumor antigens bound MHC class I, CD1 molecule
Cell Type: Epithelial cells, T cells
Biology Area: Adaptive Immunity, Immunology
Molecular Family: TCRs
Antigen References: 1. Lanier LL, et al. 1987. J. Clin. Immunol. 7:429. 2. Spencer J, et al. 1989. Eur. J. Immunol. 19:1335. 3. Uyemura K, et al. 1991. J. Exp. Med. 174:683. 4. Spada FM, et al. 2000. J. Exp. Med. 191:907.
Gene ID: 69646965
UniProt: View information about TCR gamma/delta on UniProt.org
Clone: B1
Regulatory Status: RUO
Other Names: T cell receptor γ/δ, γ/δ TCR, TCR-γ/δ
Isotype: Mouse IgG1, κ
Barcode Sequence: CTTCCGATTCATTCA


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924