Iright
BRAND / VENDOR: Biolegend

Biolegend, 333923, TotalSeq™-D0028 anti-human CD30 Antibody, 10μg

CATALOG NUMBER: 333923
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

CD30, also known as Ki-1 antigen, lymphoid activation antigen CD30, and tumor necrosis factor receptor superfamily member 8 is a type I transmembrane receptor that contains four TNF receptor domains with an approximate molecular weight of 64 kD. CD30 is highly expressed on Hodgkins and Reed-Sternberg cells as well as activated, but not resting, T and B cells. CD30 has been shown to interact with a number of proteins including TRAF1, TRAF2, TRAF3, TRAF5, NPM-ALK, TRAF-interacting protein, and CD30 ligand (CD153). Signaling through CD30 is thought to limit the proliferative potential of autoreactive CD8 effector T cells and protect against autoimmunity.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Recombinant human CD30 boosted with THP-1 cell line
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported application: in combination with IL-2 and PMA to induce T cell clone proliferation.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Leca G, et al. 1994. Cell. Immunol. 156:230.
RRID: AB_2904358 (BioLegend Cat. No. 333923)
Structure: Type I transmembrane receptor and member of the TNF receptor superfamily that contains 4 TNF receptor domains; predicted molecular weight approximately 64 kD
Distribution: Highly expressed on Hodgkins and Reed-Sternberg cells and activated, but not resting, T cells and B cells.
Function: Signaling through CD30 is thought to limit the proliferative potential of autoreactive CD8 effector T cells and protect against autoimmunity.
Interaction: TRAF1, TRAF2, TRAF3, TRAF5, NPM-ALK, TRAF-interacting protein, CD30 ligand (CD153)
Ligand/Receptor: CD30 Ligand (CD153)
Cell Type: B cells, Embryonic Stem Cells, Tregs
Biology Area: Immunology, Stem Cells
Molecular Family: CD Molecules
Antigen References: 1. Durkop H, et al. 1992. Cell 68:421. 2. Aizawa S, et al. 1997. J. Biol. Chem. 272:2042. 3. Stein H, et al. 1982. Int. J. Cancer 30:445.
Gene ID: 943
UniProt: View information about CD30 on UniProt.org
Clone: BY88
Regulatory Status: RUO
Workshop: V BP173
Other Names: Ber-H2, Ki-1, TNFRSF8
Isotype: Mouse IgG1, κ
Barcode Sequence: TCAGGGTGTGCTGTA


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924