Iright
BRAND / VENDOR: Biolegend

Biolegend, 334133, TotalSeq™-D0394 anti-human CD71 Antibody, 10μg

CATALOG NUMBER: 334133
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

CD71 is a 95 kD type II homodimeric transmembrane glycoprotein also known as T9 and transferrin receptor. It is expressed on proliferating cells, reticulocytes, and erythroid precursors. CD71 plays a role in the control of cellular proliferation by facilitating the uptake of iron via ferrotransferrin binding and the recycling of apotransferrin to the cell surface.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: NALM-6 pre-B cell line
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
RRID: AB_2892405 (BioLegend Cat. No. 334133)
Structure: Transferrin receptor family, type II glycoprotein, 95 kD
Distribution: Proliferating cells, reticulocytes, erythroid precursors
Function: Mediates uptake of iron
Ligand/Receptor: Transferrin
Biology Area: Immunology
Molecular Family: CD Molecules
Antigen References: 1. Hentze M, et al. 1996. P. Natl. Acad. Sci. USA 93:8175. 2. Trowbridge I, et al. 1993. Annu. Rev. Cell Biol. 9:129.
Gene ID: 7037
UniProt: View information about CD71 on UniProt.org
Clone: CY1G4
Regulatory Status: RUO
Workshop: A015
Other Names: T9, Transferrin receptor
Isotype: Mouse IgG2a, κ
Barcode Sequence: CCGTGTTCCTCATTA


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924