Product Description
CD97 is a seven-span transmembrane protein belonging to the secretin receptor superfamily, the G-protein-coupled receptor superfamily, and the EGF-TM7 family with molecular weights of 74 kD, 80 kD, and 86 kD. It is expressed on monocytes/macrophages, granulocytes, dendritic cells, and smooth muscle cells.The expression of CD97 on resting T- and B-lymphocytes is at low level, but is rapidly upregulated upon activation. CD97 binds to CD55 (decay-accelerating factor), chondroitin sulfate, integrin a5b1, and a3b1. CD97 has been shown to mediate cell adhesion and co-stimulation of T cell proliferation.
10μg
Verified Reactivity: Human
Reported Reactivity: Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: KG1a (human myeloid cell line)
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Clone VIM3b bindswithin the first EGF domain of CD97.4 Additional reported applications include: western blot, immunoprecipitation.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Hamann J, et al. 1995. J. Immunol. 155:1942. Lawrence DW, et al. 2003. J. Exp. Med. 198:999. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC) Wobus M, et al. 2004. Int. J. Cancer 112:815.
RRID: AB_2936600 (BioLegend Cat. No. 336315)
Structure: Seven-span transmembrane protein belonging to the secretin receptor superfamily, the G-protein-coupled receptor superfamily, and the EGF-TM7 family, 74 kD, 80 kD, 86 kD
Distribution: Monocytes/macrophages, granulocytes, dendritic cells, low levels on T cells and B-lymphocytes and upregulated upon activation
Function: Co-stimulation, adhesion
Ligand/Receptor: CD55, chondroitin sulfate, integrin α5β1, integrin α3β1
Cell Type: Dendritic cells, Granulocytes, Macrophages, Monocytes
Biology Area: Immunology
Molecular Family: CD Molecules
Antigen References: 1. Capasso M, et al. 2006. J. Immunol. 177:1070 2. Wang T, et al. 2005. Blood 105:2836 3. Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. A John Wiley & Sons Inc, Publication
Gene ID: 976
UniProt: View information about CD97 on UniProt.org
Clone: VIM3b
Regulatory Status: RUO
Workshop: V BP030
Other Names: BL-KDD/F12
Isotype: Mouse IgG1, κ
Barcode Sequence: TTAACCCGTCGATTT
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924