Iright
BRAND / VENDOR: Biolegend

Biolegend, 336429, TotalSeq™-D0372 anti-human CD61 Antibody, 10μg

CATALOG NUMBER: 336429
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • ddddd

    99 xxxxxx

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

CD61, also known as integrin β3 and glycoprotein IIIa (gpIIIa), is a 90 kD type I integral transmembrane glycoprotein. It is a member of the integrin family, associating with platelet gpIIb (CD41) to form CD41/CD61 complex and with integrin αV (CD51) to form αV/β3 (CD51/CD61) integrin. CD41/CD61 is expressed on platelets and megakaryocytes, and plays a role in platelet activation and aggregation through interaction with fibrinogen, fibronectin, vWF, and other RGD-containing adhesion molecules. CD51/CD61 is expressed on platelets, osteoclasts, fibroblasts, macrophages, and some tumor cells involved in tumor metastasis, and in adenovirus infection through binding to RGD motif in extracellular matrix proteins.
10μg
Verified Reactivity: Human, Cynomolgus, Rhesus
Reported Reactivity: African Green, Baboon
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: Western blotting and immunohistochemical staining of frozen tissue sections.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Davies J, et al. 1989. J. Cell Biol. 109:1817. Roberts M, et al. 2004. Mol. Cell. Biol. 24:1505. Ciarlet M, et al. 2002. J. Virol. 76:1109.
RRID: AB_2922555 (BioLegend Cat. No. 336429)
Structure: Type I integral glycoprotein, integrin family, associates with CD41 (gpIIb) forming CD41/CD61 complex or with CD51 (integrin αV) forming CD51/CD61 complex, 90 kD
Distribution: CD41/CD61 complex is expressed on platelets and megakaryocytes; CD51/CD61 complex is expressed on platelets, osteoclasts, fibroblasts, macrophages, and some tumor cells
Function: Adhesion, platelet activation and aggregation
Ligand/Receptor: Fibronectin, vitronectin, vWF
Cell Type: Fibroblasts, Megakaryocytes, Osteoclasts, Platelets
Biology Area: Immunology
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules: The CD Markers.
Gene ID: 3690
UniProt: View information about CD61 on UniProt.org
Clone: VI-PL2
Regulatory Status: RUO
Other Names: Integrin β3, gpIIIa
Isotype: Mouse IgG1, κ
Barcode Sequence: AGGTTGGAGTAGACT


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924