Product Description
CD79 is a heterodimeric molecule comprised of an α-chain (CD79a) and β-chain (CD79b). A 37-39 kD type I integral membrane protein CD79b is non-covalently associated with CD79a and cell surface IgM to form the B-cell receptor (BCR) complex. CD79b is expressed on the surface of surface Ig (sIg)-positive B cells and in the cytoplasm of sIg-negative B cells. It is essential for signal transduction after surface Ig crosslinking.
10μg
Verified Reactivity: Human
Reported Reactivity: African Green, Baboon, Cynomolgus, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Nakamura T, et al. 1992. P. Natl. Acad. Sci. USA 89:8522. Garcia Vela J, et al. 1999. Leukemia. 13:1501. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC) Rossi EA, et al. 2014. PLoS One. 9:98315. PubMed
RRID: AB_2922559 (BioLegend Cat. No. 341421)
Structure: 37-39 kD type I integral membrane protein, associate with CD79a and cell surface IgM to form the B-cell receptor (BCR) complex, Ig superfamily.
Distribution: B cells
Function: From BCR complex, signal transduction
Cell Type: B cells
Biology Area: Immunology
Molecular Family: CD Molecules
Antigen References: 1. Zola H, et al. Eds. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. A John Wiley & Sons Inc. 2. Dylke J, et al. 2007. Immunol. Lett. 112:47
Gene ID: 974
UniProt: View information about CD79b on UniProt.org
Clone: CB3-1
Regulatory Status: RUO
Workshop: VI CD79.1
Other Names: Igb, Igβ (Ig-beta), B29
Isotype: Mouse IgG1, κ
Barcode Sequence: ATTCTTCAACCGAAG
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924