Biolegend, 342623, TotalSeq™-D0918 anti-human HLA-E Antibody, 10μg

HLA-E is a non-classical MHC class I (MHC-Ib) molecule. It is characterized by limited polymorphism and ubiquitous expression. HLA-E, as other MHC-I molecules, is heterodimerized with β2-microglobulin. HLA-E interacts with CD94/NKG2 receptor to regulate NK cell cytolysis activities.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Lee N, et al. 1998. Proc. Natl. Acad. Sci. USA. 95:5199. Wooden SL, et al. 2005. J. Immunol. 175:1383. Monaco EL, et al. 2008. J. Immunol. 181:5442. Corrah TW, et al. 2011. J. Virol. 85:3367. PubMed
RRID: AB_2894584 (BioLegend Cat. No. 342623)
Structure: HLA family, Ig superfamily, 42 kD
Distribution: Broadly expressed
Function: Mediate cell recognition by NK cells
Ligand/Receptor: CD94/NKG2
Biology Area: Immunology
Molecular Family: MHC Antigens
Antigen References: 1. Sullivan LC, et al. 2008. Tissue Antigen. 72:415. 2. Koller BH, et al. 1988. J. Immunol. 141:897.
Gene ID: 3133
UniProt: View information about HLA-E on UniProt.org
Clone: 3D12
Regulatory Status: RUO
Other Names: HLA class I histocompatibility antigen, alpha chain E, HLAE
Isotype: Mouse IgG1, κ
Barcode Sequence: GAGTCGAGAAATCAT