Biolegend, 343133, TotalSeq™-D0066 anti-human CD7 Antibody, 10μg

CD7 is a 40 kD type I transmembrane glycoprotein also known as gp40. It is a member of the immunoglobulin superfamily found on T cells, NK cells, thymocytes, hematopoietic progenitors, and monocytes (weakly). CD7 is also expressed on acute lymphocytic leukemia (ALL) and some acute myeloid leukemia (AML) cells. CD7 crosslinking induces a calcium flux in T lymphocytes, presumably as a result of cytoplasmic domain association with PI3-kinase. CD7 costimulation can induce cytokine secretion and modulate cellular adhesion.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: KG1a cell line
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported (for the relevant formats) applications include proteogenomics2.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Knapp W, et al. 1989. Leucocyte Typing IV:White Cell Differentiation Antigens. Oxford University Press. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
RRID: AB_2892413 (BioLegend Cat. No. 343133)
Structure: Ig superfamily, type I transmembrane glycoprotein, 40 kD
Distribution: T cells, NK cells, thymocytes, hematopoietic progenitors, myeloid leukemic cell subsets
Function: T cell activation
Ligand/Receptor: Cytoplasmic domain associates with P13-kinase
Cell Type: Hematopoietic stem and progenitors, Leukemia, NK cells, T cells, Thymocytes
Biology Area: Costimulatory Molecules, Immunology
Molecular Family: CD Molecules
Antigen References: 1. Barclay N, et al. 1993. The Leucocyte Antigen FactsBook. Academic Press Inc. San Diego. 2. Stillwell R, et al. 2001. Immunol. Res. 24:31. 3. Rabinowich H, et al. 1994. J. Immunol. 152:517.
Gene ID: 924
UniProt: View information about CD7 on UniProt.org
Clone: CD7-6B7
Regulatory Status: RUO
Workshop: IV T-164
Other Names: gp40
Isotype: Mouse IgG2a, κ
Barcode Sequence: TGGATTCCCGGACTT