Iright
BRAND / VENDOR: Biolegend

Biolegend, 343543, TotalSeq™-D0054 anti-human CD34 Antibody, 10μg

CATALOG NUMBER: 343543
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

CD34, also known as gp105-120, is a type I monomeric sialomucin-like glycophosphoprotein with an approximate molecular weight of 105-120 kD. Selectively expressed on the majority of hematopoietic stem/progenitor cells, bone marrow stromal cells, capillary endothelial cells, embryonic fibroblasts, and some nervous tissue, CD34 is a commonly used marker to identify human hematopoietic stem/progenitor cells. According to the differential sensitivity to enzymatic cleavage, four groups of epitopes of CD34 have been described. CD34 mediates cell adhesion and lymphocytes homing through binding to L-selectin and E-selectin ligands.
10μg
Verified Reactivity: Human
Reported Reactivity: Cynomolgus
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: The 581 antibody recognizes the class III group epitope which is resistant to sialidase/glycolyprotease and chymopapain treatment. Additional reported applications (for the relevant formats) include: immunohistochemical staining of paraffin-embedded tissue sections5 and immunofluorescence6.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Schlossman SF, et al. 1995. Leukocyte Typing V:White Cell Differentiation Antigen. New York:Oxford University Press. Felschow DM, et al. 2001. Blood 97:3768. Rudin CE, et al. 1997. Br. J. Haematol. 97:488. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC) Skowasch D, et al. 2003. Cardiovasc Res. 60:684. (IHC) Umland O, et al. 2003. J. Histochem. Cytochem. 51:977. (IF)
RRID: AB_2892416 (BioLegend Cat. No. 343543)
Structure: 105-120 kD single chain mucin-like glycoprotein
Distribution: Hematopoietic stem/progenitor cells, bone marrow stromal cells, endothelial cells, embryonic fibroblasts
Function: Cell adhesion
Ligand/Receptor: L-selectin, E-selectin
Cell Type: Endothelial cells, Fibroblasts, Hematopoietic stem and progenitors
Biology Area: Cell Biology, Immunology, Neuroinflammation, Neuroscience, Stem Cells
Molecular Family: CD Molecules
Antigen References: 1. Krause DS, et al. 1996. Blood 87:1. 2. Puri KD, et al. 1995. J. Cell Biol. 131:261. 3. Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. John Wiley & Sons Inc, Hoboken New Jersey.
Gene ID: 947
UniProt: View information about CD34 on UniProt.org
Clone: 581
Regulatory Status: RUO
Workshop: V MA27
Other Names: Gp105-120, My10
Isotype: Mouse IgG1, κ
Barcode Sequence: GCAGAAATCTCCCTT


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924