Iright
BRAND / VENDOR: Biolegend

Biolegend, 343915, TotalSeq™-D1015 anti-human CD166 Antibody, 10μg

CATALOG NUMBER: 343915
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

CD166, also known as the CD6 ligand or the Activated Leukocyte Cell Adhesion Molecule (ALCAM), is a 100-105 kD transmembrane glycoprotein. It belongs to the Ig superfamily of proteins and expressed on activated T cells, activated monocytes, epithelial cells, fibroblasts, and neurons. CD166 plays an important role in mediating adhesion interactions between thymic epithelial cells and CD6+ cells during intrathymic T cell development. Recently CD166 has also been used as a potential cancer stem cell marker. The antibody reacts with human activated leukocyte cell adhesion molecule (ALCAM).
10μg
Verified Reactivity: Human
Reported Reactivity: African Green, Baboon, Cynomolgus, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Cultured human thymic epithelial cells
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: immunohistochemical staining of paraffin-embedded tissue sections and immunofluorescence.1
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Pretzel D, et al. 2011. Arthritis Res. Ther. 13:R64. (IHC, IF, FC)
RRID: AB_2894541 (BioLegend Cat. No. 343915)
Structure: A type I transmembrane glycoprotein belonging to the Ig superfamily of proteins.
Distribution: CD166 is expressed on activated T cells, activated monocytes, epithelial cells, fibroblasts, and neurons.
Function: Play an important role in mediating adhesion interactions between thymic epithelial cells and CD6+ cells during intrathymic T cell development.
Ligand/Receptor: CD6
Cell Type: Epithelial cells, Fibroblasts, Mesenchymal Stem Cells, Monocytes, Neurons, T cells
Biology Area: Immunology, Stem Cells
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Aruffo A, et al. 1997. Immunol Today. 18(10):498 2. Patel DD, et al. 1995. J. Exp. Med. 181:2213 3. Bowen MA, et al. 1995. J. Exp. Med. 181:1563 4. Horst D, et al. 2009. Cancer Invest. 22:1
Gene ID: 214
UniProt: View information about CD166 on UniProt.org
Clone: 3A6
Regulatory Status: RUO
Workshop: HCDM listed
Other Names: CD6 ligand, Activated Leukocyte Cell Adhesion Molecule (ALCAM)
Isotype: Mouse IgG1, κ
Barcode Sequence: CATAAGATTCCGAGC


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924