Biolegend, 354245, TotalSeq™-D0370 anti-human CD303 (BDCA-2) Antibody, 10μg

CD303, also known as BDCA-2 and CLEC4C, is a 38 kD type II transmembrane glycoprotein. It is a member of the C-type lectin superfamily. CD303 is expressed by plasmacytoid dendritic cells (pDCs) and is involved in cell adhesion, signaling, and antigen capture and processing. Crosslinking of CD303 inhibits the production of IFN-α/β and TLR-9 induced pDCs maturation.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Freeman A, et al. 2014. PLoS One. 9:110928. PubMed Johnson P, et al. 2015. Clin Cnacer Res. 21:1321. PubMed
RRID: AB_2892429 (BioLegend Cat. No. 354245)
Structure: Type II transmembrane protein, 38 kD, member of the C-type lectin superfamily
Distribution: Plasmacytoid dendritic cells
Function: Antigen capture, inhibition of IFN α/β production
Cell Type: Dendritic cells
Biology Area: Costimulatory Molecules, Immunology, Innate Immunity
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Jähn PS, et al. 2010. Cell Immunol. 265:15. 2. Graham LM and Brown GD. 2009. Cytokine 48:148. 3. Röck J, et al. 2007. Eur. J. Immunol. 37:3564. 4. Dzionek A, et al. 2001. J. Exp. Med. 194:1823.
Gene ID: 170482
UniProt: View information about CD303 on UniProt.org
Clone: 201A
Regulatory Status: RUO
Other Names: CLEC4C, CLECSF11, CLECSF7, DLEC, HECL
Isotype: Mouse IgG2a, κ
Barcode Sequence: GAGATGTCCGAATTT