Product Description
CD185, also known as CXCR5, is a 42 kD G-protein coupled receptor with seven transmembrane regions. CXCR5 is expressed by mature B cells, follicular helper T cells, Burkitt’s lymphoma cells and a subset of neurons, and mediates cell migration to the B cell follicles in the secondary lymphoid organs. The ligand of CXCR5 is CXCL13 (BLC).
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human CXCR5-transfected cells
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
RRID: AB_2894546 (BioLegend Cat. No. 356949)
Structure: G-protein coupled receptor, 7 transmembrane regions, 42 kD
Distribution: Mature B cells, Follicular helper T cells, and Burkitt's lymphoma cells.
Function: Mediates cell migration to the B cell follicles in the secondary lymphoid organs
Ligand/Receptor: CXCL13
Cell Type: B cells, Tfh
Biology Area: Cell Biology, Immunology, Neuroinflammation, Neuroscience
Molecular Family: CD Molecules, Cytokine/Chemokine Receptors, GPCR
Antigen References: 1. Ma CS, et al. 2012. J. Exp. Med. 209:1241. 2. León B, et al. 2012. Nat. Immunol. 13:681. 3. Crotty S. 2011. Annu. Rev. Immunol. 29:621. 4. Kerfoot SM, et al. 2011. Immunity 34:947. 5. Sáez de Guinoa J, et al. 2011. Blood 118:1560.
Gene ID: 643
UniProt: View information about CD185 on UniProt.org
Clone: J252D4
Regulatory Status: RUO
Other Names: BLR1, MDR15
Isotype: Mouse IgG1, κ
Barcode Sequence: AATTCAACCGTCGCC
Q: Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?
A: Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924