Iright
BRAND / VENDOR: Biolegend

Biolegend, 359431, TotalSeq™-D0071 anti-human CD194 (CCR4) Antibody, 10μg

CATALOG NUMBER: 359431
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

CD194, also known as CCR4, is a CC chemokine receptor. It binds CCL17 and CCL22 and is expressed on a subset of T and B cells, basophils, monocytes, and NK cells. Human Th2 cells are characterized by the expression of CCR4 and CCR8, and these receptors are regulated differently during Th2 development. Human peripheral blood Tregs can be divided into two distinct populations based on the expression of CCR4. Freshly isolated Tregs express CCR4 and presumably represent memory-type Tregs, and CCR4 - Tregs require CD3-mediated activation to acquire a regulatory activity. Depletion of CCR4 + T cells leads to Th1-type polarization of CD4 + T cells and augmentation of CD8 + T cell responses to tumor antigens. CCR4 and its ligands are important for the recruitment of memory T cells into the skin in various cutaneous immune diseases.
10μg
Verified Reactivity: Human
Reported Reactivity: Cynomolgus
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human CCR4 transfected cells
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna. The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
RRID: AB_2894569 (BioLegend Cat. No. 359431)
Structure: GPCR, seven transmembrane receptor
Distribution: Expressed on a subset of T and B cells, basophils, monocytes, NK cells
Function: Migration of inflammatory and regulatory cells to the target tissues
Ligand/Receptor: CCL17 and CCL22
Cell Type: B cells, Basophils, Embryonic Stem Cells, Monocytes, NK cells, T cells, Tregs
Biology Area: Immunology, Innate Immunity, Stem Cells
Molecular Family: CD Molecules, Cytokine/Chemokine Receptors, GPCR
Antigen References: 1. Katschke KJ, et al. 2001 Arthritis Rheum. 44:1022. 2. Colantonio L, et al. 2002 Eur. J. Immunol. 32:1264. 3. Jakubzick C et al. 2004 Am. J. Pathol. 165:1211. 4. Morimoto Y, et al. 2005 J. Leukoc. Biol. 78:753. 5. Baatar J, et al. 2007 J. Immunol. 178:4891. 6. Kusumoto M, et al. 2007 J. Interferon. Cytokine Res. 27:901.
Gene ID: 1233
UniProt: View information about CD194 on UniProt.org
Clone: L291H4
Regulatory Status: RUO
Other Names: CKR4, K5-5, CMKBR4, ChemR13, CC-CKR-4, MGC88293, HGCN:14099
Isotype: Mouse IgG1, κ
Barcode Sequence: AGCTTACCTGCACGA
Q: Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?
A: Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924