Biolegend, 367735, TotalSeq™-D0153 anti-human KLRG1 (MAFA) Antibody, 10μg

Killer cell lectin-like receptor subfamily G member 1 (KLRG1) is a 30 kD, type II membrane glycoprotein with one C-type lectin domain and one immunoreceptor tyrosine-based inhibititory motif (ITIM). KLRG1 is expressed by subsets of NK, effector and memory T cells. KLRG1 inhibits cell activation and proliferation, and is a marker of T cell senescence. Binding of KLRG1 to E-, N-, or R- cadherins blocks phosphorylation of Akt and increases the expression of cell cycle inhibitors.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human KLRG1-transfected cells
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
RRID: AB_2894623 (BioLegend Cat. No. 367735)
Structure: Type II membrane glycoprotein, one C-type lectin domain, one ITIM, 30 kD.
Distribution: Subsets of NK, effector and memory T cells.
Function: Inhibits cell activation and proliferation, marker of T cell senescence.
Interaction: AKT
Ligand/Receptor: E-, N-, and R- cadherins
Cell Type: NK cells, T cells
Biology Area: Immunology, Innate Immunity
Antigen References: 1. Shi L, et al. 2014. J. Immunol. 192:649.
Gene ID: 10219
UniProt: View information about KLRG1 on UniProt.org
Clone: SA231A2
Regulatory Status: RUO
Other Names: CLEC15A, MAFA-L, MAFA-2F1, MAFA-LIKE, 2F1
Isotype: Mouse IgG2a, κ
Barcode Sequence: CTTATTTCCTGCCCT