Biolegend, 371915, TotalSeq™-D0399 anti-human CD204 Antibody, 10μg

CD204, also known as scavenger receptor A (SR-A) and the macrophage scavenger receptor (MSR), is one of the phagocytic pattern-recognition receptors (PRRs) expressed on macrophages and dendritic cells. CD204 was initially identified as a receptor mediating recognition and internalization of low-density lipoprotein (LDL) by macrophages and playing critical roles in atherogenesis. CD204 recognizes apoptotic cells, modified lipid proteins, and exogenous pathogen-associated molecular patterns (PAMPs), which results in the induction of innate immune and inflammatory responses. CD204 can act as a co-receptor for Toll-like receptors, such as TLR3, TLR4, or TLR9, to facilitate the expression of proinflammatory cytokines. CD204 has been implicated in several pathological processes such as Alzheimer’s disease, sepsis, ischemic injury, and coronary artery disease.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Recombinant extracellular domain of human CD204.
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
RRID: AB_2941542 (BioLegend Cat. No. 371915)
Structure: Type II transmembraine protein, trimer, member of the scavenger receptor familly.
Distribution: Macrophages, dendritic cells, strong expression in microglia during Alzheimer's disease.
Function: Uptake of negatively charged molecules.
Antigen References: 1. Kelley JL, et al. 2014. Crit. Rev. Immunol. 34:241. 2. Chen Y, et al. 2011. Blood. 118:390. 3. Yu X, et al. 2011. J. Biol. Chem. 286:18795. 4. Limmon GV, et al. 2008. FASEB J. 22:159.
Gene ID: 4481
UniProt: View information about CD204 on UniProt.org
Clone: 7C9C20
Regulatory Status: RUO
Other Names: CD204, Macrophage scavenger receptor, MSR, MSR1, SRA
Isotype: Mouse IgG2a, κ
Barcode Sequence: TAGCGAGCCAGATGT