Iright
BRAND / VENDOR: Biolegend

Biolegend, 375133, TotalSeq™-D1374 anti-human CD159a (NKG2A) Antibody, 10μg

CATALOG NUMBER: 375133
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

CD159a, also known as NKG2A or KLRC1, is a type II transmembrane protein. It belongs to the killer cell lectin-like receptor family also known as the NKG2 family. It is expressed on NK and NKT cells and T cell subsets. NKG2A is an inhibitory NK cell receptor and it is expressed as a heterodimer with CD94. In human, NKG2A/CD94 complex interacts HLA-E on target cells and inhibits T cells and NK cell effector functions. Recent studies showed that NKG2A blockade enhances the anti-tumor effect of NK cell and CD8 + T cells.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human NKG2A/CD94-transfectants
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Clone S19004C does not cross-react with mouse CD159a.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
RRID: AB_2936648 (BioLegend Cat. No. 375133)
Structure: Type II transmembrane proteins of the C-type lectin superfamily
Distribution: NK cells, NKT cells, T cell subsets
Function: Inhibiting NK cell receptor
Ligand/Receptor: HLA-E
Cell Type: Lymphocytes, NK cells, NKT cells, T cells
Biology Area: Immuno-Oncology, Immunology
Molecular Family: Immune Checkpoint Receptors
Antigen References: Brooks AG, et al. 1999. J Immunol. 162:305-13. Kaiser BK, et al. 2008. Proc Natl Acad Sci U S A. 105: 6696-701. Braud VM, et al. 2003. Trends Immunol. 24:162-4. Kamiya T, et al. 2019. J Clin Invest. 129:2094. André P, et al. 2018. Cell. 175:1731.
Gene ID: 3821
UniProt: View information about CD159a on UniProt.org
Clone: S19004C
Regulatory Status: RUO
Other Names: Killer Cell Lectin Like Receptor C1, KLRC1, NK Cell Receptor A
Isotype: Mouse IgG1, κ
Barcode Sequence: CAACTCCTGGGACTT


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924