Iright
BRAND / VENDOR: Proteintech

Proteintech, G13602-1-5C, MultiPro® 5CFLX Anti-Human CD122/IL-2RB (Polyclonal)

CATALOG NUMBER: G13602-1-5C
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description
Size: 10ug The CD122/IL-2RB (G13602-1-5C) by Proteintech is a Polyclonal antibody targeting CD122/IL-2RB in Single Cell (Intra) applications with reactivity to Human samples G13602-1-5C targets CD122/IL-2RB in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information The interleukin 2 receptor, which is involved in T cell-mediated immune responses, is present in 3 forms with respect to ability to bind interleukin 2. The low affinity form is a monomer of the alpha subunit and is not involved in signal transduction. The intermediate affinity form consists of an alpha/beta subunit heterodimer, while the high affinity form consists of an alpha/beta/gamma subunit heterotrimer. The beta subunit (IL2RB, also known as CD122 and p75) is involved in receptor mediated endocytosis and transduces the mitogenic signals of nterleukin 2. Specification Tested Reactivity: Human Host / Isotype: Rabbit / IgG Class: Oligo Conjugate Type: Polyclonal Immunogen: CatNo: Ag3929 Product name: Recombinant human IL-2RB protein Source: e coli. -derived, PGEX-4T Tag: GST Domain: 270-551 aa of BC025691 Sequence: TGPWLKKVLKCNTPDPSKFFSQLSSEHGGDVQKWLSSPFPSSSFSPGGLAPEISPLEVLERDKVTQLLLQQDKVPEPASLSSNHSLTSCFTNQGYFFFHLPDALEIEACQVYFTYDPYSEEDPDEGVAGAPTGSSPQPLQPLSGEDDAYCTFPSRDDLLLFSPSLLGGPSPPSTAPGGSGAGEERMPPSLQERVPRDWDPQPLGPPTPGVPDLVDFQPPPELVLREAGEEVPDAGPREGVSFPWSRPPGQGEFRALNARLPLNTDAYLSLQELQGQDPTHLV Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD122/IL-2RB (Polyclonal) Calculated Molecular Weight: 551 aa, 61 kDa GenBank Accession Number: BC025691 Gene Symbol: IL2RB Gene ID (NCBI): 3560 ENSEMBL Gene ID: ENSG00000100385 RRID: AB_3673884 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGGTCTGTGACAGCGACCCATATAAGAAA Barcode Sequence: GGTCTGTGACAGCGA Form: Liquid UNIPROT ID: P14784 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924