Iright
BRAND / VENDOR: Proteintech

Proteintech, G20189-1-5C, MultiPro® 5CFLX Anti-Human MAFB (Polyclonal)

CATALOG NUMBER: G20189-1-5C
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description
Size: 10ug The MAFB (G20189-1-5C) by Proteintech is a Polyclonal antibody targeting MAFB in Single Cell (Intra) applications with reactivity to Human samples G20189-1-5C targets MAFB in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information MAFB (MAF BZIP Transcription Factor B), also known as V-maf musculoaponeurotic fibrosarcoma oncogene homolog B, is a widely expressed basic leucine zipper transcription factor belonging to the Maf family. MAFB expression is significantly elevated in response to a broad range of metabolic and immunological stimuli that promote macrophage M2 polarization, cholesterol efflux, or both, whereas it is strongly down-regulated in response to various pro-inflammatory pathogenic triggers(PMID: 28790455). MAFB is highly expressed in tumor tissues and required for proliferation and tumorigenicity of osteosarcoma cells(PMID: 32234710) and is a marker of tumor-associated macrophages in both mouse and human(PMID: 31679694). Specification Tested Reactivity: Human Host / Isotype: Rabbit / IgG Class: Oligo Conjugate Type: Polyclonal Immunogen: CatNo: Ag14102 Product name: Recombinant human MAFB protein Source: e coli. -derived, PGEX-4T Tag: GST Domain: 168-323 aa of BC036689 Sequence: QASPPPSSAASPAQQLPTSHPGPGPHATASATAAGGNGSVEDRFSDDQLVSMSVRELNRHLRGFTKDEVIRLKQKRRTLKNRGYAQSCRYKRVQQKHHLENEKTQLIQQVEQLKQEVSRLARERDAYKVKCEKLANSGFREAGSTSDSPSSPEFFL Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human MAFB (Polyclonal) Calculated Molecular Weight: 323 aa, 36 kDa GenBank Accession Number: BC036689 Gene Symbol: MAFB Gene ID (NCBI): 9935 ENSEMBL Gene ID: ENSG00000204103 RRID: AB_3673893 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTCGCGGACCAGGAATCCCATATAAGAAA Barcode Sequence: TCGCGGACCAGGAAT Form: Liquid UNIPROT ID: Q9Y5Q3 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924