Iright
BRAND / VENDOR: Proteintech

Proteintech, G60007-1-5C, MultiPro® 5CFLX Anti-Human TGFBI/BIGH3 (3E11D11)

CATALOG NUMBER: G60007-1-5C
Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • In stock, ready to ship

  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description
Size: 10ug The TGFBI / BIGH3 (G60007-1-5C) by Proteintech is a Monoclonal antibody targeting TGFBI / BIGH3 in Single Cell (Intra) applications with reactivity to Human samples G60007-1-5C targets TGFBI / BIGH3 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information TGFBI, also named as BIGH3, Kerato-epithelin and RGD-CAP, binds to type I, II, and IV collagens. TGFBI is an adhesion protein which may play an important role in cell-collagen interactions. In cartilage, it may be involved in endochondral bone formation. TGFBI is an extracellular matrix adaptor protein, it has been reported to be differentially expressed in transformed tissues. TGFBI is a predictive factor of the response to chemotherapy, and suggest the use of TGFBI-derived peptides as possible therapeutic adjuvants for the enhancement of responses to chemotherapy.(PMID:20509890) Defects in TGFBI are the cause of epithelial basement membrane corneal dystrophy (EBMD). Defects in TGFBI are the cause of corneal dystrophy Groenouw type 1 (CDGG1). Defects in TGFBI are the cause of corneal dystrophy lattice type 1 (CDL1). Defects in TGFBI are a cause of corneal dystrophy Thiel-Behnke type (CDTB). Defects in TGFBI are the cause of Reis-Buecklers corneal dystrophy (CDRB). Defects in TGFBI are the cause of lattice corneal dystrophy type 3A (CDL3A). Defects in TGFBI are the cause of Avellino corneal dystrophy (ACD). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG2a Class: Oligo Conjugate Type: Monoclonal Immunogen: CatNo: Ag0241 Product name: Recombinant human BIGH3 protein Source: e coli. -derived, PGEX-4T Tag: GST Domain: 199-406 aa of BC000097 Sequence: NIQIHHYPNGIVTVNCARLLKADHHATNGVVHLIDKVISTITNNIQQIIEIEDTFETLRAAVAASGLNTMLEGNGQYTLLAPTNEAFEKIPSETLNRILGDPEALRDLLNNHILKSAMCAEAIVAGLSVETLEGTTLEVGCSGDMLTINGKAIISNKDILATNGVIHYIDELLIPDSAKTLFELAAESDVSTAIDLFRQAGLGNHLSG Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human TGFBI/BIGH3 (3E11D11) Calculated Molecular Weight: 683 aa, 75 kDa GenBank Accession Number: BC000097 Gene Symbol: TGFBI Gene ID (NCBI): 7045 ENSEMBL Gene ID: ENSG00000120708 RRID: AB_3673898 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTCCAAGGTAACTGCGCCCATATAAGAAA Barcode Sequence: TCCAAGGTAACTGCG Form: Liquid UNIPROT ID: Q15582 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924