Proteintech, G65051-1-5C, MultiPro® 5CFLX Anti-Human CD107a/LAMP1 (H4A3)

Size: 10ug The CD107a / LAMP1 (G65051-1-5C) by Proteintech is a Monoclonal antibody targeting CD107a / LAMP1 in Single Cell (Intra) applications with reactivity to Human samples G65051-1-5C targets CD107a / LAMP1 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information LAMP1 (CD107a) is a heavily glycosylated membrane protein enriched in the lysosomal membrane. LAMP1 is extensively glycosylated with asparagine-linked oligosaccharides which protect it from intracellular proteolysis (PMID: 10521503). Although LAMP1 is expressed largely in the endosome-lysosomal membrane of cells, it is also found on the plasma membrane (PMID: 16168398). Elevated LAMP1 expression at the cell surface has also been detected during platelet and granulocytic cell activation, as well as in some tumor cells (PMID: 29085473). LAMP1 functions to provide selectins with carbohydrate ligands. This protein has also been shown to be a marker of degranulation on lymphocytes such as CD8+ and NK cells and may also play a role in tumor cell differentiation and metastasis (PMID: 18835598; 29085473; 9426697). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Human adherent peripheral blood cells Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD107a/LAMP1 (H4A3) Calculated Molecular Weight: 45 kDa GenBank Accession Number: BC006345 Gene Symbol: LAMP1 Gene ID (NCBI): 3916 ENSEMBL Gene ID: ENSG00000185896 RRID: AB_3673904 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTACTTCGGATTATATCCCATATAAGAAA Barcode Sequence: TACTTCGGATTATAT Form: Liquid UNIPROT ID: P11279 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.