Proteintech, G65053-1-5C, MultiPro® 5CFLX Anti-Human CD107b/LAMP2 (H4B4)

Size: 10ug The CD107b / LAMP2 (G65053-1-5C) by Proteintech is a Monoclonal antibody targeting CD107b / LAMP2 in Single Cell (Intra) applications with reactivity to Human samples G65053-1-5C targets CD107b / LAMP2 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information LAMP2 (CD107b) is a Lysosomal membrane glycoprotein. LAMP2 is extensively glycosylated with asparagine-linked oligosaccharides which protect it from intracellular proteolysis (PMID: 10521503). Although LAMP-2 is localized primarily in the endosome-lysosomal membrane of cells, it is also found on the plasma membrane under certain circumstances, e.g., after platelet activation, during granulocytic differentiation and activation, and in some tumor cells (PMID: 12221139). LAMP is involved in lysosomal stability and autophagy (PMID: 12221139). This glycoprotein provides selectins with carbohydrate ligands. LAMP2 may plays a role in tumor cell metastasis (PMID 9426697). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Human adherent peripheral blood cells Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD107b/LAMP2 (H4B4) Calculated Molecular Weight: 45 kDa GenBank Accession Number: BC002965 Gene Symbol: LAMP2 Gene ID (NCBI): 3920 ENSEMBL Gene ID: ENSG00000005893 RRID: AB_3673905 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCGTTCTCCATCTTGCCCATATAAGAAA Barcode Sequence: CCGTTCTCCATCTTG Form: Liquid UNIPROT ID: P13473 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.