Proteintech, G65075-1-5C, MultiPro® 5CFLX Anti-Human CD54/ICAM-1 (15.2)

Size: 10ug The CD54 (ICAM-1) (G65075-1-5C) by Proteintech is a Monoclonal antibody targeting CD54 (ICAM-1) in Single Cell (Intra) applications with reactivity to Human samples G65075-1-5C targets CD54 (ICAM-1) in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information ICAM-1 (CD54) is a 90-kDa transmembrane glycoprotein of the immunoglobulin superfamily and is critical for the firm attachment and transmigration of leukocytes out of blood vessels and into tissues (PMID: 19307690). ICAM-1 is expressed by several cell types, typically on endothelial cells and cells of the immune system, and its expression can be up-regulated by various stimuli, including TNF-α, INF-γ, IL-1 and thrombin (PMID: 3086451; 9694714; 15979056). It is a ligand for LFA-1 and Mac-1, serves as a receptor for rhinovirus, and is one of several receptors used by Plasmodium falciparum (PMID: 2566624; 2538244; 2475784). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Rheumatoid synovial cells and human monocytes Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD54/ICAM-1 (15.2) Calculated Molecular Weight: 90 kDa GenBank Accession Number: BC015969 Gene Symbol: ICAM-1 Gene ID (NCBI): 3383 ENSEMBL Gene ID: ENSG00000090339 RRID: AB_3673909 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGAGTGTTGTGGAGATCCCCATATAAGAAA Barcode Sequence: AGTGTTGTGGAGATC Form: Liquid UNIPROT ID: P05362 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.